Incidental Mutation 'R5890:Mfsd2b'
ID457114
Institutional Source Beutler Lab
Gene Symbol Mfsd2b
Ensembl Gene ENSMUSG00000037336
Gene Namemajor facilitator superfamily domain containing 2B
SynonymsGm1964
MMRRC Submission 044091-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5890 (G1)
Quality Score220
Status Not validated
Chromosome12
Chromosomal Location4862440-4874359 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 4867651 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 132 (C132S)
Ref Sequence ENSEMBL: ENSMUSP00000117057 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045921] [ENSMUST00000085790] [ENSMUST00000137337] [ENSMUST00000147241]
Predicted Effect probably damaging
Transcript: ENSMUST00000045921
AA Change: C235S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000045315
Gene: ENSMUSG00000037336
AA Change: C235S

DomainStartEndE-ValueType
Pfam:MFS_2 33 472 4.6e-74 PFAM
low complexity region 476 490 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000085790
AA Change: C235S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000082945
Gene: ENSMUSG00000037336
AA Change: C235S

DomainStartEndE-ValueType
Pfam:MFS_2 32 346 2.2e-56 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125344
Predicted Effect probably damaging
Transcript: ENSMUST00000137337
AA Change: C132S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000117057
Gene: ENSMUSG00000037336
AA Change: C132S

DomainStartEndE-ValueType
Pfam:MFS_2 1 368 1.1e-59 PFAM
low complexity region 373 387 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143446
Predicted Effect probably benign
Transcript: ENSMUST00000147241
SMART Domains Protein: ENSMUSP00000114977
Gene: ENSMUSG00000037336

DomainStartEndE-ValueType
Pfam:MFS_2 33 110 3.1e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150764
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153676
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous KO reduces sphingosine-1-phosphate export from, and increases its accumulation in, red blood cells and platelets, and leads to reduced leukocyte, reticulocyte, and erythrocyte cell numbers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik C T 11: 78,273,270 Q40* probably null Het
Abcc9 A G 6: 142,604,828 probably null Het
Acsm3 C A 7: 119,775,234 T303N probably benign Het
Adamts13 A T 2: 26,986,591 R506W probably damaging Het
Adck5 C T 15: 76,593,585 T166M probably damaging Het
Adcy8 T A 15: 64,815,417 I413F probably damaging Het
Adgrl2 A T 3: 148,859,175 D252E probably damaging Het
Aldh16a1 T A 7: 45,144,545 T636S probably benign Het
Ampd1 C A 3: 103,090,075 F264L probably damaging Het
Arhgap17 T C 7: 123,286,758 probably benign Het
Babam2 A G 5: 32,064,807 probably benign Het
Bod1l T A 5: 41,820,578 E1131V probably benign Het
Cbs C T 17: 31,613,219 V553M probably damaging Het
Cd72 T C 4: 43,454,475 K18R probably damaging Het
Cep89 A G 7: 35,429,162 Y580C probably damaging Het
Chrnb1 T A 11: 69,792,729 I264F possibly damaging Het
Cntf A G 19: 12,763,993 W168R probably damaging Het
Cxxc1 T A 18: 74,221,166 D648E possibly damaging Het
Cyp2c68 A T 19: 39,712,492 L294Q probably damaging Het
Dab2ip T C 2: 35,715,402 S532P probably damaging Het
Defb3 G A 8: 19,295,184 C52Y probably damaging Het
Dennd5a T G 7: 109,934,221 E114A probably benign Het
Dnah12 T C 14: 26,706,884 F222L probably benign Het
Dock9 A C 14: 121,668,408 probably null Het
Fras1 A T 5: 96,645,948 H1043L probably benign Het
Gamt C A 10: 80,259,907 R63L possibly damaging Het
Gm1527 A G 3: 28,915,395 H298R probably benign Het
Gphb5 C T 12: 75,415,822 probably null Het
Greb1 A T 12: 16,733,421 V104D possibly damaging Het
Hck A G 2: 153,129,076 D86G probably damaging Het
Jhy T A 9: 40,922,662 K321* probably null Het
Kcna5 C T 6: 126,534,736 R143H probably damaging Het
Kif19a G T 11: 114,789,438 W867L possibly damaging Het
Map3k4 G A 17: 12,271,416 A376V probably damaging Het
Mars A T 10: 127,298,045 M661K probably benign Het
Mecp2 C T X: 74,035,437 V496M probably damaging Het
Mfsd4a T C 1: 132,038,928 Y356C probably damaging Het
Mif4gd G T 11: 115,609,362 A89E probably benign Het
Mkln1 A T 6: 31,490,547 E593D probably benign Het
Mlh1 G T 9: 111,228,495 N749K possibly damaging Het
Mrgprb2 T A 7: 48,551,959 *339C probably null Het
Nphp4 T C 4: 152,547,079 V812A probably benign Het
Nrcam G T 12: 44,576,771 V1048L probably benign Het
Obsl1 G A 1: 75,493,859 A856V probably damaging Het
Osgepl1 T A 1: 53,318,167 F163I probably damaging Het
Pcdha6 C A 18: 36,969,068 T438K possibly damaging Het
Pcdhb20 A T 18: 37,505,233 M271L probably benign Het
Phip T C 9: 82,906,952 T770A probably benign Het
Ppm1d A G 11: 85,326,908 T166A probably damaging Het
Ptprf A T 4: 118,224,735 I1102K probably benign Het
Sbsn T C 7: 30,753,267 V569A possibly damaging Het
Skida1 T A 2: 18,046,003 probably benign Het
Smg1 T A 7: 118,190,586 probably benign Het
Sorcs2 A G 5: 36,229,191 Y168H probably damaging Het
Sufu A T 19: 46,454,733 probably null Het
Tbc1d24 A T 17: 24,185,526 W215R probably damaging Het
Tenm4 T C 7: 96,902,860 L2502P probably damaging Het
Tgm4 A T 9: 123,061,638 E10V probably damaging Het
Trip11 T C 12: 101,885,972 E611G probably damaging Het
Ttn C A 2: 76,709,899 A34248S possibly damaging Het
Ube3a T A 7: 59,272,028 N49K probably damaging Het
Ube3c A G 5: 29,658,292 D855G possibly damaging Het
Ugt8a A G 3: 125,875,553 S301P probably benign Het
Wdfy4 T A 14: 33,102,577 N1295I possibly damaging Het
Wdr47 G T 3: 108,610,012 G43C probably damaging Het
Wdtc1 A C 4: 133,294,362 L601W unknown Het
Zfp236 A G 18: 82,640,151 F614S possibly damaging Het
Zfp637 T A 6: 117,845,086 D58E possibly damaging Het
Other mutations in Mfsd2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01810:Mfsd2b APN 12 4866469 missense possibly damaging 0.63
IGL03188:Mfsd2b APN 12 4866538 splice site probably null
IGL03339:Mfsd2b APN 12 4874335 start codon destroyed probably null
R0142:Mfsd2b UTSW 12 4866234 missense probably benign 0.11
R1468:Mfsd2b UTSW 12 4870536 nonsense probably null
R1468:Mfsd2b UTSW 12 4870536 nonsense probably null
R1535:Mfsd2b UTSW 12 4870605 missense probably damaging 1.00
R1718:Mfsd2b UTSW 12 4869037 missense probably damaging 1.00
R1894:Mfsd2b UTSW 12 4869155 missense probably damaging 0.99
R2127:Mfsd2b UTSW 12 4867659 missense probably benign 0.01
R2392:Mfsd2b UTSW 12 4865164 missense possibly damaging 0.73
R3737:Mfsd2b UTSW 12 4870578 missense probably damaging 1.00
R3738:Mfsd2b UTSW 12 4870578 missense probably damaging 1.00
R3739:Mfsd2b UTSW 12 4870578 missense probably damaging 1.00
R3956:Mfsd2b UTSW 12 4866848 missense probably damaging 1.00
R4035:Mfsd2b UTSW 12 4870578 missense probably damaging 1.00
R4244:Mfsd2b UTSW 12 4874356 utr 5 prime probably benign
R4595:Mfsd2b UTSW 12 4865807 missense possibly damaging 0.87
R4667:Mfsd2b UTSW 12 4867636 missense probably benign 0.01
R4723:Mfsd2b UTSW 12 4868992 missense probably benign 0.03
R5126:Mfsd2b UTSW 12 4866183 missense probably benign 0.30
R5145:Mfsd2b UTSW 12 4865908 unclassified probably benign
R5976:Mfsd2b UTSW 12 4866522 missense probably damaging 1.00
R6753:Mfsd2b UTSW 12 4867358 missense possibly damaging 0.90
R6912:Mfsd2b UTSW 12 4870611 nonsense probably null
R7182:Mfsd2b UTSW 12 4866157 critical splice donor site probably null
X0062:Mfsd2b UTSW 12 4865170 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AAGAAGTTCAGGCCTTGGC -3'
(R):5'- AGACAAAGCCAGCACCTGTG -3'

Sequencing Primer
(F):5'- CTGAGGCTGGGGCAGAAGTATC -3'
(R):5'- ACCTGTGCACTTTTGGAATGC -3'
Posted On2017-02-15