Incidental Mutation 'R5890:Cntf'
ID457135
Institutional Source Beutler Lab
Gene Symbol Cntf
Ensembl Gene ENSMUSG00000079415
Gene Nameciliary neurotrophic factor
Synonyms
MMRRC Submission 044091-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5890 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location12763660-12765632 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 12763993 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 168 (W168R)
Ref Sequence ENSEMBL: ENSMUSP00000108555 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038627] [ENSMUST00000112933] [ENSMUST00000142247]
Predicted Effect probably benign
Transcript: ENSMUST00000038627
SMART Domains Protein: ENSMUSP00000037971
Gene: ENSMUSG00000024695

DomainStartEndE-ValueType
low complexity region 21 27 N/A INTRINSIC
low complexity region 35 43 N/A INTRINSIC
low complexity region 72 92 N/A INTRINSIC
low complexity region 98 114 N/A INTRINSIC
low complexity region 120 135 N/A INTRINSIC
low complexity region 143 167 N/A INTRINSIC
low complexity region 207 226 N/A INTRINSIC
coiled coil region 256 284 N/A INTRINSIC
ZnF_C2H2 313 338 1.08e-1 SMART
ZnF_C2H2 344 368 7.15e-2 SMART
ZnF_C2H2 374 396 1.56e-2 SMART
ZnF_C2H2 402 424 2.61e-4 SMART
ZnF_C2H2 432 455 1.92e-2 SMART
low complexity region 459 471 N/A INTRINSIC
low complexity region 491 502 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112933
AA Change: W168R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108555
Gene: ENSMUSG00000079415
AA Change: W168R

DomainStartEndE-ValueType
Pfam:CNTF 1 194 4.2e-109 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142247
SMART Domains Protein: ENSMUSP00000124424
Gene: ENSMUSG00000024695

DomainStartEndE-ValueType
low complexity region 21 27 N/A INTRINSIC
low complexity region 35 43 N/A INTRINSIC
low complexity region 72 92 N/A INTRINSIC
low complexity region 98 114 N/A INTRINSIC
low complexity region 120 135 N/A INTRINSIC
low complexity region 143 167 N/A INTRINSIC
low complexity region 207 226 N/A INTRINSIC
coiled coil region 256 284 N/A INTRINSIC
ZnF_C2H2 313 338 1.08e-1 SMART
ZnF_C2H2 344 368 7.15e-2 SMART
ZnF_C2H2 374 396 1.56e-2 SMART
ZnF_C2H2 402 424 2.61e-4 SMART
ZnF_C2H2 432 455 1.92e-2 SMART
low complexity region 459 471 N/A INTRINSIC
low complexity region 491 502 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a polypeptide hormone whose actions appear to be restricted to the nervous system where it promotes neurotransmitter synthesis and neurite outgrowth in certain neuronal populations. The protein is a potent survival factor for neurons and oligodendrocytes, and it may be involved in reducing tissue destruction during inflammatory attacks. A read-through transcript variant composed of Zfp91 and Cntf sequences has been identified, but it is thought to be non-coding. Read-through transcription of Zfp91 and Cntf has been observed in both human and mouse. [provided by RefSeq, Aug 2008]
PHENOTYPE: Mice homozygous for a disruption in this gene display progressive atrophy and degeneration of motor neurons in adulthood and reduced muscle strength. Another allele does not display any overt abnormalities at birth, however motor neuron sprouting does not occur after damage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik C T 11: 78,273,270 Q40* probably null Het
Abcc9 A G 6: 142,604,828 probably null Het
Acsm3 C A 7: 119,775,234 T303N probably benign Het
Adamts13 A T 2: 26,986,591 R506W probably damaging Het
Adck5 C T 15: 76,593,585 T166M probably damaging Het
Adcy8 T A 15: 64,815,417 I413F probably damaging Het
Adgrl2 A T 3: 148,859,175 D252E probably damaging Het
Aldh16a1 T A 7: 45,144,545 T636S probably benign Het
Ampd1 C A 3: 103,090,075 F264L probably damaging Het
Arhgap17 T C 7: 123,286,758 probably benign Het
Babam2 A G 5: 32,064,807 probably benign Het
Bod1l T A 5: 41,820,578 E1131V probably benign Het
Cbs C T 17: 31,613,219 V553M probably damaging Het
Cd72 T C 4: 43,454,475 K18R probably damaging Het
Cep89 A G 7: 35,429,162 Y580C probably damaging Het
Chrnb1 T A 11: 69,792,729 I264F possibly damaging Het
Cxxc1 T A 18: 74,221,166 D648E possibly damaging Het
Cyp2c68 A T 19: 39,712,492 L294Q probably damaging Het
Dab2ip T C 2: 35,715,402 S532P probably damaging Het
Defb3 G A 8: 19,295,184 C52Y probably damaging Het
Dennd5a T G 7: 109,934,221 E114A probably benign Het
Dnah12 T C 14: 26,706,884 F222L probably benign Het
Dock9 A C 14: 121,668,408 probably null Het
Fras1 A T 5: 96,645,948 H1043L probably benign Het
Gamt C A 10: 80,259,907 R63L possibly damaging Het
Gm1527 A G 3: 28,915,395 H298R probably benign Het
Gphb5 C T 12: 75,415,822 probably null Het
Greb1 A T 12: 16,733,421 V104D possibly damaging Het
Hck A G 2: 153,129,076 D86G probably damaging Het
Jhy T A 9: 40,922,662 K321* probably null Het
Kcna5 C T 6: 126,534,736 R143H probably damaging Het
Kif19a G T 11: 114,789,438 W867L possibly damaging Het
Map3k4 G A 17: 12,271,416 A376V probably damaging Het
Mars A T 10: 127,298,045 M661K probably benign Het
Mecp2 C T X: 74,035,437 V496M probably damaging Het
Mfsd2b A T 12: 4,867,651 C132S probably damaging Het
Mfsd4a T C 1: 132,038,928 Y356C probably damaging Het
Mif4gd G T 11: 115,609,362 A89E probably benign Het
Mkln1 A T 6: 31,490,547 E593D probably benign Het
Mlh1 G T 9: 111,228,495 N749K possibly damaging Het
Mrgprb2 T A 7: 48,551,959 *339C probably null Het
Nphp4 T C 4: 152,547,079 V812A probably benign Het
Nrcam G T 12: 44,576,771 V1048L probably benign Het
Obsl1 G A 1: 75,493,859 A856V probably damaging Het
Osgepl1 T A 1: 53,318,167 F163I probably damaging Het
Pcdha6 C A 18: 36,969,068 T438K possibly damaging Het
Pcdhb20 A T 18: 37,505,233 M271L probably benign Het
Phip T C 9: 82,906,952 T770A probably benign Het
Ppm1d A G 11: 85,326,908 T166A probably damaging Het
Ptprf A T 4: 118,224,735 I1102K probably benign Het
Sbsn T C 7: 30,753,267 V569A possibly damaging Het
Skida1 T A 2: 18,046,003 probably benign Het
Smg1 T A 7: 118,190,586 probably benign Het
Sorcs2 A G 5: 36,229,191 Y168H probably damaging Het
Sufu A T 19: 46,454,733 probably null Het
Tbc1d24 A T 17: 24,185,526 W215R probably damaging Het
Tenm4 T C 7: 96,902,860 L2502P probably damaging Het
Tgm4 A T 9: 123,061,638 E10V probably damaging Het
Trip11 T C 12: 101,885,972 E611G probably damaging Het
Ttn C A 2: 76,709,899 A34248S possibly damaging Het
Ube3a T A 7: 59,272,028 N49K probably damaging Het
Ube3c A G 5: 29,658,292 D855G possibly damaging Het
Ugt8a A G 3: 125,875,553 S301P probably benign Het
Wdfy4 T A 14: 33,102,577 N1295I possibly damaging Het
Wdr47 G T 3: 108,610,012 G43C probably damaging Het
Wdtc1 A C 4: 133,294,362 L601W unknown Het
Zfp236 A G 18: 82,640,151 F614S possibly damaging Het
Zfp637 T A 6: 117,845,086 D58E possibly damaging Het
Other mutations in Cntf
AlleleSourceChrCoordTypePredicted EffectPPH Score
R4890:Cntf UTSW 19 12763962 missense possibly damaging 0.91
R5148:Cntf UTSW 19 12764004 missense probably damaging 1.00
R6992:Cntf UTSW 19 12765333 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACAGCCAGAATAACCATGTTTATC -3'
(R):5'- AGAGAGTGCATTTCACCCCG -3'

Sequencing Primer
(F):5'- CCTACTTGACGAAATATGCCTGTGG -3'
(R):5'- ATTTCACCCCGACTGAAGGTG -3'
Posted On2017-02-15