Incidental Mutation 'R5891:Nlrp12'
ID457177
Institutional Source Beutler Lab
Gene Symbol Nlrp12
Ensembl Gene ENSMUSG00000078817
Gene NameNLR family, pyrin domain containing 12
SynonymsNalp12
MMRRC Submission 044092-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.121) question?
Stock #R5891 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location3218784-3249740 bp(-) (GRCm38)
Type of Mutationutr 3 prime
DNA Base Change (assembly) T to A at 3219259 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000104293 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108653]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104627
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104694
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104710
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104815
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104838
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104841
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104847
Predicted Effect probably benign
Transcript: ENSMUST00000108653
SMART Domains Protein: ENSMUSP00000104293
Gene: ENSMUSG00000078817

DomainStartEndE-ValueType
PYRIN 9 91 1.84e-24 SMART
FISNA 128 201 1.71e-24 SMART
Pfam:NACHT 211 381 4.2e-52 PFAM
LRR 705 732 6.78e-3 SMART
LRR 734 761 2.13e1 SMART
LRR 762 789 3.49e-5 SMART
LRR 791 818 7.02e0 SMART
LRR 819 846 6.52e-5 SMART
LRR 848 875 6.92e-1 SMART
LRR 876 903 2.47e-5 SMART
LRR 905 932 3.78e0 SMART
LRR 933 960 1.63e-5 SMART
LRR 962 989 4.9e0 SMART
LRR 990 1017 1.79e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196199
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196383
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.9%
Validation Efficiency 96% (85/89)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the CATERPILLER family of cytoplasmic proteins. The encoded protein, which contains an N-terminal pyrin domain, a NACHT domain, a NACHT-associated domain, and a C-terminus leucine-rich repeat region, functions as an attenuating factor of inflammation by suppressing inflammatory responses in activated monocytes. Mutations in this gene cause familial cold autoinflammatory syndrome type 2. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2013]
PHENOTYPE: Mice homozygous for a null allele have defects in dendritic and myeloid cell migration and a decreased susceptibility to type IV hypersensitivity reactions. Mice homozygous for a second null allele display increased susceptibility to induced colitis and to chemically-induced tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik A G 15: 8,188,589 I828V probably benign Het
A430105I19Rik T A 2: 118,761,383 D92V probably damaging Het
Abi3bp A T 16: 56,606,133 T504S probably damaging Het
Adamtsl4 C A 3: 95,682,313 R387L possibly damaging Het
Adgb G A 10: 10,377,847 Q1224* probably null Het
Ankrd40 T A 11: 94,334,863 F240Y probably damaging Het
Asnsd1 A T 1: 53,347,977 Y164N probably benign Het
Atf7ip A T 6: 136,559,977 E69D possibly damaging Het
Atm T C 9: 53,497,159 T1129A probably benign Het
AU021092 T C 16: 5,212,131 D340G probably benign Het
Baz2a T A 10: 128,121,322 I978N probably damaging Het
BC034090 T C 1: 155,233,047 probably benign Het
Bcl9 A G 3: 97,208,888 L830P probably damaging Het
Bicral T C 17: 46,801,229 N1015S probably benign Het
Ceacam3 C A 7: 17,151,793 T107N probably damaging Het
Cep83 T C 10: 94,725,675 V109A probably benign Het
Ces1e A G 8: 93,203,266 V463A possibly damaging Het
Ciao1 A G 2: 127,247,134 V55A probably benign Het
Col19a1 T C 1: 24,289,725 E900G probably damaging Het
Commd3 A G 2: 18,673,815 probably benign Het
Coro1c A G 5: 113,850,811 I157T probably damaging Het
Ctso T A 3: 81,954,254 F311L probably benign Het
Cxcl10 A G 5: 92,348,224 probably benign Het
Daam1 C A 12: 71,944,149 T179N unknown Het
Ddx24 T C 12: 103,424,058 K225E probably damaging Het
Dnajc16 T C 4: 141,775,392 T278A probably benign Het
Dnajc2 A T 5: 21,761,711 N345K possibly damaging Het
Dnpep G T 1: 75,311,812 Q395K probably benign Het
Dync1h1 T C 12: 110,614,220 probably null Het
Exoc1 A G 5: 76,542,144 D177G probably damaging Het
Fam135b C T 15: 71,525,803 R136H probably damaging Het
Fam214a C G 9: 75,004,386 C46W probably damaging Het
Filip1 T G 9: 79,819,860 L492F possibly damaging Het
Flvcr2 A T 12: 85,796,228 I359F possibly damaging Het
Gmcl1 A G 6: 86,707,443 W366R probably damaging Het
Htt A G 5: 34,870,823 T1808A possibly damaging Het
Ighv5-4 C A 12: 113,597,629 R57L probably damaging Het
Il12rb2 A T 6: 67,360,690 I69N probably damaging Het
Irf5 A T 6: 29,529,425 probably benign Het
Kif13b T G 14: 64,788,405 probably null Het
Klkb1 T A 8: 45,270,666 T571S probably benign Het
Mapkbp1 G T 2: 120,023,932 E1337* probably null Het
Met A G 6: 17,491,539 D100G probably benign Het
Mgam T A 6: 40,744,348 D183E probably benign Het
Mrgprb13 T C 7: 48,312,259 noncoding transcript Het
Mrgprx2 T C 7: 48,482,246 T275A probably benign Het
Mroh2a C A 1: 88,241,615 Q671K possibly damaging Het
Nckipsd T A 9: 108,808,609 S42R probably damaging Het
Olfr1297 A T 2: 111,621,433 L214M probably damaging Het
Olfr361 T A 2: 37,084,978 M257L probably benign Het
Olfr467 C T 7: 107,815,180 P199S probably damaging Het
Olfr527 C T 7: 140,336,600 T246I probably benign Het
Otoa T A 7: 121,132,360 probably null Het
Pfkm T A 15: 98,122,690 C233* probably null Het
Pikfyve A G 1: 65,202,737 Y212C probably damaging Het
Ptprq T A 10: 107,576,895 D1781V possibly damaging Het
Pttg1ip A G 10: 77,582,440 probably benign Het
Rab6a T A 7: 100,639,247 probably null Het
Rbm11 C T 16: 75,598,837 A132V possibly damaging Het
Sept4 G T 11: 87,588,924 probably benign Het
Serpinb8 A G 1: 107,605,845 E210G probably damaging Het
Sertad2 G A 11: 20,647,884 G27S probably benign Het
Slco5a1 A G 1: 12,990,402 F32L probably benign Het
Smad2 A G 18: 76,299,975 E326G probably damaging Het
Sp9 T A 2: 73,274,251 L383Q probably damaging Het
Stx11 T C 10: 12,941,815 N55S probably damaging Het
Tbc1d15 T A 10: 115,220,308 Q253L probably benign Het
Tcf7l1 T A 6: 72,637,051 probably benign Het
Tdrd9 T A 12: 112,042,719 S1020T probably damaging Het
Tead3 A T 17: 28,341,365 D88E probably damaging Het
Tnrc18 A G 5: 142,815,171 S11P probably damaging Homo
Trpc3 G T 3: 36,671,022 D268E probably damaging Het
Ttn A G 2: 76,745,741 V23190A possibly damaging Het
Ubr4 T A 4: 139,408,626 Y908* probably null Het
Urb2 G T 8: 124,030,856 V1101L possibly damaging Het
Usp9y A T Y: 1,341,535 D1375E probably benign Het
Zcchc7 T C 4: 44,895,838 L262P probably damaging Het
Zdhhc7 T A 8: 120,084,900 H188L probably benign Het
Zfp518a T A 19: 40,912,433 C269S probably damaging Het
Zfp933 T C 4: 147,826,774 K90E probably benign Het
Other mutations in Nlrp12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00733:Nlrp12 APN 7 3240757 missense probably damaging 1.00
IGL01301:Nlrp12 APN 7 3240092 missense probably damaging 1.00
IGL01346:Nlrp12 APN 7 3240686 missense probably damaging 1.00
IGL01482:Nlrp12 APN 7 3235160 missense possibly damaging 0.65
IGL01534:Nlrp12 APN 7 3239833 missense probably benign 0.03
IGL02106:Nlrp12 APN 7 3233944 missense probably benign 0.02
IGL02159:Nlrp12 APN 7 3249545 utr 5 prime probably benign
IGL02184:Nlrp12 APN 7 3240464 missense probably damaging 0.99
IGL02221:Nlrp12 APN 7 3240967 missense possibly damaging 0.89
IGL02252:Nlrp12 APN 7 3245350 missense probably benign 0.01
ANU18:Nlrp12 UTSW 7 3240092 missense probably damaging 1.00
PIT4280001:Nlrp12 UTSW 7 3241433 missense possibly damaging 0.94
R0033:Nlrp12 UTSW 7 3240407 missense probably damaging 1.00
R0033:Nlrp12 UTSW 7 3240407 missense probably damaging 1.00
R0090:Nlrp12 UTSW 7 3240034 missense probably damaging 0.99
R0446:Nlrp12 UTSW 7 3234029 missense probably benign 0.00
R0503:Nlrp12 UTSW 7 3249377 missense probably damaging 0.97
R0538:Nlrp12 UTSW 7 3249262 missense possibly damaging 0.56
R1114:Nlrp12 UTSW 7 3228534 missense probably benign
R1680:Nlrp12 UTSW 7 3241174 missense probably damaging 1.00
R2030:Nlrp12 UTSW 7 3228417 missense probably damaging 1.00
R2096:Nlrp12 UTSW 7 3233195 missense probably benign 0.05
R2118:Nlrp12 UTSW 7 3241449 missense probably damaging 1.00
R2266:Nlrp12 UTSW 7 3233945 missense probably benign 0.00
R3615:Nlrp12 UTSW 7 3240575 missense probably benign 0.00
R3616:Nlrp12 UTSW 7 3240575 missense probably benign 0.00
R4375:Nlrp12 UTSW 7 3240946 missense possibly damaging 0.88
R4376:Nlrp12 UTSW 7 3240946 missense possibly damaging 0.88
R4379:Nlrp12 UTSW 7 3239924 missense probably benign 0.08
R4837:Nlrp12 UTSW 7 3231061 missense probably damaging 1.00
R4856:Nlrp12 UTSW 7 3240442 missense probably damaging 1.00
R4970:Nlrp12 UTSW 7 3240983 missense possibly damaging 0.72
R5112:Nlrp12 UTSW 7 3240983 missense possibly damaging 0.72
R5147:Nlrp12 UTSW 7 3241373 missense possibly damaging 0.79
R5505:Nlrp12 UTSW 7 3249385 missense probably damaging 0.99
R5636:Nlrp12 UTSW 7 3225294 missense probably damaging 0.99
R6039:Nlrp12 UTSW 7 3241372 missense possibly damaging 0.79
R6039:Nlrp12 UTSW 7 3241372 missense possibly damaging 0.79
R6365:Nlrp12 UTSW 7 3239888 missense probably benign 0.00
R6383:Nlrp12 UTSW 7 3234043 missense probably damaging 1.00
R6796:Nlrp12 UTSW 7 3241409 missense probably damaging 1.00
R6886:Nlrp12 UTSW 7 3240683 missense probably benign 0.03
R6957:Nlrp12 UTSW 7 3222486 missense probably damaging 1.00
R6995:Nlrp12 UTSW 7 3239851 missense probably benign
R7340:Nlrp12 UTSW 7 3233125 missense possibly damaging 0.93
R7346:Nlrp12 UTSW 7 3249257 missense probably damaging 0.96
R7387:Nlrp12 UTSW 7 3241201 missense probably damaging 0.97
R7414:Nlrp12 UTSW 7 3241347 missense probably benign 0.01
R7432:Nlrp12 UTSW 7 3222539 missense probably benign 0.14
X0064:Nlrp12 UTSW 7 3241386 missense probably benign 0.14
X0065:Nlrp12 UTSW 7 3240575 missense probably benign 0.00
Z1088:Nlrp12 UTSW 7 3222537 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGGGTCCTATCCTAAAGAGGGC -3'
(R):5'- CCAACTTCCAAGACCTGAGG -3'

Sequencing Primer
(F):5'- TCCTATCCTAAAGAGGGCGGTTC -3'
(R):5'- TTCCAAGACCTGAGGCTCAG -3'
Posted On2017-02-15