Incidental Mutation 'R5891:Fam214a'
ID457192
Institutional Source Beutler Lab
Gene Symbol Fam214a
Ensembl Gene ENSMUSG00000034858
Gene Namefamily with sequence similarity 214, member A
SynonymsBC031353, C130047D21Rik, 6330415I01Rik
MMRRC Submission 044092-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.389) question?
Stock #R5891 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location74952884-75032468 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 75004386 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tryptophan at position 46 (C46W)
Ref Sequence ENSEMBL: ENSMUSP00000149021 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081746] [ENSMUST00000170846] [ENSMUST00000214755] [ENSMUST00000215370]
Predicted Effect probably damaging
Transcript: ENSMUST00000081746
AA Change: C53W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000080442
Gene: ENSMUSG00000034858
AA Change: C53W

DomainStartEndE-ValueType
low complexity region 349 360 N/A INTRINSIC
internal_repeat_1 361 458 7.22e-14 PROSPERO
internal_repeat_1 473 570 7.22e-14 PROSPERO
low complexity region 840 859 N/A INTRINSIC
DUF4210 885 943 8.5e-29 SMART
Pfam:Chromosome_seg 1024 1081 3.5e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000170846
AA Change: C46W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129319
Gene: ENSMUSG00000034858
AA Change: C46W

DomainStartEndE-ValueType
low complexity region 342 353 N/A INTRINSIC
internal_repeat_1 354 451 8.38e-14 PROSPERO
internal_repeat_1 466 563 8.38e-14 PROSPERO
low complexity region 833 852 N/A INTRINSIC
DUF4210 878 936 8.5e-29 SMART
Pfam:Chromosome_seg 1016 1074 1.8e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214755
AA Change: C46W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000215370
AA Change: C46W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.436 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.9%
Validation Efficiency 96% (85/89)
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik A G 15: 8,188,589 I828V probably benign Het
A430105I19Rik T A 2: 118,761,383 D92V probably damaging Het
Abi3bp A T 16: 56,606,133 T504S probably damaging Het
Adamtsl4 C A 3: 95,682,313 R387L possibly damaging Het
Adgb G A 10: 10,377,847 Q1224* probably null Het
Ankrd40 T A 11: 94,334,863 F240Y probably damaging Het
Asnsd1 A T 1: 53,347,977 Y164N probably benign Het
Atf7ip A T 6: 136,559,977 E69D possibly damaging Het
Atm T C 9: 53,497,159 T1129A probably benign Het
AU021092 T C 16: 5,212,131 D340G probably benign Het
Baz2a T A 10: 128,121,322 I978N probably damaging Het
BC034090 T C 1: 155,233,047 probably benign Het
Bcl9 A G 3: 97,208,888 L830P probably damaging Het
Bicral T C 17: 46,801,229 N1015S probably benign Het
Ceacam3 C A 7: 17,151,793 T107N probably damaging Het
Cep83 T C 10: 94,725,675 V109A probably benign Het
Ces1e A G 8: 93,203,266 V463A possibly damaging Het
Ciao1 A G 2: 127,247,134 V55A probably benign Het
Col19a1 T C 1: 24,289,725 E900G probably damaging Het
Commd3 A G 2: 18,673,815 probably benign Het
Coro1c A G 5: 113,850,811 I157T probably damaging Het
Ctso T A 3: 81,954,254 F311L probably benign Het
Cxcl10 A G 5: 92,348,224 probably benign Het
Daam1 C A 12: 71,944,149 T179N unknown Het
Ddx24 T C 12: 103,424,058 K225E probably damaging Het
Dnajc16 T C 4: 141,775,392 T278A probably benign Het
Dnajc2 A T 5: 21,761,711 N345K possibly damaging Het
Dnpep G T 1: 75,311,812 Q395K probably benign Het
Dync1h1 T C 12: 110,614,220 probably null Het
Exoc1 A G 5: 76,542,144 D177G probably damaging Het
Fam135b C T 15: 71,525,803 R136H probably damaging Het
Filip1 T G 9: 79,819,860 L492F possibly damaging Het
Flvcr2 A T 12: 85,796,228 I359F possibly damaging Het
Gmcl1 A G 6: 86,707,443 W366R probably damaging Het
Htt A G 5: 34,870,823 T1808A possibly damaging Het
Ighv5-4 C A 12: 113,597,629 R57L probably damaging Het
Il12rb2 A T 6: 67,360,690 I69N probably damaging Het
Irf5 A T 6: 29,529,425 probably benign Het
Kif13b T G 14: 64,788,405 probably null Het
Klkb1 T A 8: 45,270,666 T571S probably benign Het
Mapkbp1 G T 2: 120,023,932 E1337* probably null Het
Met A G 6: 17,491,539 D100G probably benign Het
Mgam T A 6: 40,744,348 D183E probably benign Het
Mrgprb13 T C 7: 48,312,259 noncoding transcript Het
Mrgprx2 T C 7: 48,482,246 T275A probably benign Het
Mroh2a C A 1: 88,241,615 Q671K possibly damaging Het
Nckipsd T A 9: 108,808,609 S42R probably damaging Het
Nlrp12 T A 7: 3,219,259 probably benign Het
Olfr1297 A T 2: 111,621,433 L214M probably damaging Het
Olfr361 T A 2: 37,084,978 M257L probably benign Het
Olfr467 C T 7: 107,815,180 P199S probably damaging Het
Olfr527 C T 7: 140,336,600 T246I probably benign Het
Otoa T A 7: 121,132,360 probably null Het
Pfkm T A 15: 98,122,690 C233* probably null Het
Pikfyve A G 1: 65,202,737 Y212C probably damaging Het
Ptprq T A 10: 107,576,895 D1781V possibly damaging Het
Pttg1ip A G 10: 77,582,440 probably benign Het
Rab6a T A 7: 100,639,247 probably null Het
Rbm11 C T 16: 75,598,837 A132V possibly damaging Het
Sept4 G T 11: 87,588,924 probably benign Het
Serpinb8 A G 1: 107,605,845 E210G probably damaging Het
Sertad2 G A 11: 20,647,884 G27S probably benign Het
Slco5a1 A G 1: 12,990,402 F32L probably benign Het
Smad2 A G 18: 76,299,975 E326G probably damaging Het
Sp9 T A 2: 73,274,251 L383Q probably damaging Het
Stx11 T C 10: 12,941,815 N55S probably damaging Het
Tbc1d15 T A 10: 115,220,308 Q253L probably benign Het
Tcf7l1 T A 6: 72,637,051 probably benign Het
Tdrd9 T A 12: 112,042,719 S1020T probably damaging Het
Tead3 A T 17: 28,341,365 D88E probably damaging Het
Tnrc18 A G 5: 142,815,171 S11P probably damaging Homo
Trpc3 G T 3: 36,671,022 D268E probably damaging Het
Ttn A G 2: 76,745,741 V23190A possibly damaging Het
Ubr4 T A 4: 139,408,626 Y908* probably null Het
Urb2 G T 8: 124,030,856 V1101L possibly damaging Het
Usp9y A T Y: 1,341,535 D1375E probably benign Het
Zcchc7 T C 4: 44,895,838 L262P probably damaging Het
Zdhhc7 T A 8: 120,084,900 H188L probably benign Het
Zfp518a T A 19: 40,912,433 C269S probably damaging Het
Zfp933 T C 4: 147,826,774 K90E probably benign Het
Other mutations in Fam214a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Fam214a APN 9 75025790 missense probably benign 0.28
IGL00588:Fam214a APN 9 75009581 missense probably damaging 1.00
IGL01887:Fam214a APN 9 75017057 missense probably benign 0.39
IGL02828:Fam214a APN 9 75006432 missense probably damaging 1.00
IGL03060:Fam214a APN 9 75010168 missense probably damaging 0.96
IGL03277:Fam214a APN 9 75009232 missense probably damaging 1.00
R0052:Fam214a UTSW 9 75018983 splice site probably benign
R0052:Fam214a UTSW 9 75018983 splice site probably benign
R0615:Fam214a UTSW 9 75004288 missense probably damaging 1.00
R0723:Fam214a UTSW 9 75009451 missense probably damaging 1.00
R1428:Fam214a UTSW 9 75006321 missense probably benign 0.07
R1448:Fam214a UTSW 9 75010174 nonsense probably null
R1656:Fam214a UTSW 9 75008959 missense probably benign 0.00
R2024:Fam214a UTSW 9 75010390 missense probably damaging 0.98
R3147:Fam214a UTSW 9 75008838 missense probably benign 0.25
R3745:Fam214a UTSW 9 75009862 missense probably benign 0.00
R4105:Fam214a UTSW 9 75008776 missense probably damaging 1.00
R4224:Fam214a UTSW 9 75008726 missense probably damaging 1.00
R4496:Fam214a UTSW 9 75031531 missense probably damaging 0.99
R4519:Fam214a UTSW 9 75023647 missense probably damaging 1.00
R4715:Fam214a UTSW 9 75012968 missense probably damaging 1.00
R4885:Fam214a UTSW 9 75006367 missense probably damaging 1.00
R5009:Fam214a UTSW 9 75008889 missense probably damaging 0.98
R5574:Fam214a UTSW 9 75010390 missense probably damaging 1.00
R5645:Fam214a UTSW 9 75025679 missense probably damaging 1.00
R5696:Fam214a UTSW 9 75010117 missense probably benign 0.01
R5936:Fam214a UTSW 9 75009304 missense probably benign 0.00
R6165:Fam214a UTSW 9 75025672 missense probably damaging 0.96
R6228:Fam214a UTSW 9 75006363 missense possibly damaging 0.94
R6419:Fam214a UTSW 9 75009337 missense probably benign 0.20
R6499:Fam214a UTSW 9 75023648 missense probably damaging 1.00
R6631:Fam214a UTSW 9 74953825 missense possibly damaging 0.71
R6649:Fam214a UTSW 9 75010150 missense probably damaging 0.96
R6849:Fam214a UTSW 9 75009312 missense probably damaging 0.96
R7189:Fam214a UTSW 9 75004351 missense probably damaging 0.99
R7402:Fam214a UTSW 9 75006386 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTGACTAATTCAAGTGGTGGAATTC -3'
(R):5'- GCAGCATAGAAGACTACTGTGG -3'

Sequencing Primer
(F):5'- CAGATGCCTTGGATGAGT -3'
(R):5'- AACATCGCCTCAGCTTAGGGAG -3'
Posted On2017-02-15