Incidental Mutation 'R5891:Nckipsd'
ID457194
Institutional Source Beutler Lab
Gene Symbol Nckipsd
Ensembl Gene ENSMUSG00000032598
Gene NameNCK interacting protein with SH3 domain
SynonymsAF3P21, Wasbp, SPIN90, DIP1, WISH, ORF1
MMRRC Submission 044092-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.272) question?
Stock #R5891 (G1)
Quality Score112
Status Validated
Chromosome9
Chromosomal Location108808368-108818844 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 108808609 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 42 (S42R)
Ref Sequence ENSEMBL: ENSMUSP00000035218 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035218] [ENSMUST00000085018] [ENSMUST00000193560] [ENSMUST00000194819] [ENSMUST00000195323]
Predicted Effect probably damaging
Transcript: ENSMUST00000035218
AA Change: S42R

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000035218
Gene: ENSMUSG00000032598
AA Change: S42R

DomainStartEndE-ValueType
SH3 1 57 2.21e-9 SMART
low complexity region 162 179 N/A INTRINSIC
low complexity region 200 215 N/A INTRINSIC
low complexity region 230 240 N/A INTRINSIC
low complexity region 249 271 N/A INTRINSIC
low complexity region 288 298 N/A INTRINSIC
Pfam:DUF2013 539 675 5e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000085018
SMART Domains Protein: ENSMUSP00000082091
Gene: ENSMUSG00000032599

DomainStartEndE-ValueType
Pfam:IPK 225 440 2.7e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000192678
Predicted Effect probably benign
Transcript: ENSMUST00000193560
SMART Domains Protein: ENSMUSP00000141605
Gene: ENSMUSG00000032599

DomainStartEndE-ValueType
Pfam:IPK 179 394 1.6e-61 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194413
Predicted Effect possibly damaging
Transcript: ENSMUST00000194819
AA Change: S42R

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000141702
Gene: ENSMUSG00000032598
AA Change: S42R

DomainStartEndE-ValueType
SH3 1 52 3.3e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000195323
AA Change: S42R

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000141728
Gene: ENSMUSG00000032598
AA Change: S42R

DomainStartEndE-ValueType
SH3 1 57 1.4e-11 SMART
Meta Mutation Damage Score 0.122 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.9%
Validation Efficiency 96% (85/89)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is localized exclusively in the cell nucleus. It plays a role in signal transduction, and may function in the maintenance of sarcomeres and in the assembly of myofibrils into sarcomeres. It also plays an important role in stress fiber formation. The gene is involved in therapy-related leukemia by a chromosomal translocation t(3;11)(p21;q23) that involves this gene and the myeloid/lymphoid leukemia gene. Alternative splicing results in multiple transcript variants of this gene. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a null mutation exhibit altered protein composition of postsynaptic densities and actin cytoskeleton in hippocampal neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik A G 15: 8,188,589 I828V probably benign Het
A430105I19Rik T A 2: 118,761,383 D92V probably damaging Het
Abi3bp A T 16: 56,606,133 T504S probably damaging Het
Adamtsl4 C A 3: 95,682,313 R387L possibly damaging Het
Adgb G A 10: 10,377,847 Q1224* probably null Het
Ankrd40 T A 11: 94,334,863 F240Y probably damaging Het
Asnsd1 A T 1: 53,347,977 Y164N probably benign Het
Atf7ip A T 6: 136,559,977 E69D possibly damaging Het
Atm T C 9: 53,497,159 T1129A probably benign Het
AU021092 T C 16: 5,212,131 D340G probably benign Het
Baz2a T A 10: 128,121,322 I978N probably damaging Het
BC034090 T C 1: 155,233,047 probably benign Het
Bcl9 A G 3: 97,208,888 L830P probably damaging Het
Bicral T C 17: 46,801,229 N1015S probably benign Het
Ceacam3 C A 7: 17,151,793 T107N probably damaging Het
Cep83 T C 10: 94,725,675 V109A probably benign Het
Ces1e A G 8: 93,203,266 V463A possibly damaging Het
Ciao1 A G 2: 127,247,134 V55A probably benign Het
Col19a1 T C 1: 24,289,725 E900G probably damaging Het
Commd3 A G 2: 18,673,815 probably benign Het
Coro1c A G 5: 113,850,811 I157T probably damaging Het
Ctso T A 3: 81,954,254 F311L probably benign Het
Cxcl10 A G 5: 92,348,224 probably benign Het
Daam1 C A 12: 71,944,149 T179N unknown Het
Ddx24 T C 12: 103,424,058 K225E probably damaging Het
Dnajc16 T C 4: 141,775,392 T278A probably benign Het
Dnajc2 A T 5: 21,761,711 N345K possibly damaging Het
Dnpep G T 1: 75,311,812 Q395K probably benign Het
Dync1h1 T C 12: 110,614,220 probably null Het
Exoc1 A G 5: 76,542,144 D177G probably damaging Het
Fam135b C T 15: 71,525,803 R136H probably damaging Het
Fam214a C G 9: 75,004,386 C46W probably damaging Het
Filip1 T G 9: 79,819,860 L492F possibly damaging Het
Flvcr2 A T 12: 85,796,228 I359F possibly damaging Het
Gmcl1 A G 6: 86,707,443 W366R probably damaging Het
Htt A G 5: 34,870,823 T1808A possibly damaging Het
Ighv5-4 C A 12: 113,597,629 R57L probably damaging Het
Il12rb2 A T 6: 67,360,690 I69N probably damaging Het
Irf5 A T 6: 29,529,425 probably benign Het
Kif13b T G 14: 64,788,405 probably null Het
Klkb1 T A 8: 45,270,666 T571S probably benign Het
Mapkbp1 G T 2: 120,023,932 E1337* probably null Het
Met A G 6: 17,491,539 D100G probably benign Het
Mgam T A 6: 40,744,348 D183E probably benign Het
Mrgprb13 T C 7: 48,312,259 noncoding transcript Het
Mrgprx2 T C 7: 48,482,246 T275A probably benign Het
Mroh2a C A 1: 88,241,615 Q671K possibly damaging Het
Nlrp12 T A 7: 3,219,259 probably benign Het
Olfr1297 A T 2: 111,621,433 L214M probably damaging Het
Olfr361 T A 2: 37,084,978 M257L probably benign Het
Olfr467 C T 7: 107,815,180 P199S probably damaging Het
Olfr527 C T 7: 140,336,600 T246I probably benign Het
Otoa T A 7: 121,132,360 probably null Het
Pfkm T A 15: 98,122,690 C233* probably null Het
Pikfyve A G 1: 65,202,737 Y212C probably damaging Het
Ptprq T A 10: 107,576,895 D1781V possibly damaging Het
Pttg1ip A G 10: 77,582,440 probably benign Het
Rab6a T A 7: 100,639,247 probably null Het
Rbm11 C T 16: 75,598,837 A132V possibly damaging Het
Sept4 G T 11: 87,588,924 probably benign Het
Serpinb8 A G 1: 107,605,845 E210G probably damaging Het
Sertad2 G A 11: 20,647,884 G27S probably benign Het
Slco5a1 A G 1: 12,990,402 F32L probably benign Het
Smad2 A G 18: 76,299,975 E326G probably damaging Het
Sp9 T A 2: 73,274,251 L383Q probably damaging Het
Stx11 T C 10: 12,941,815 N55S probably damaging Het
Tbc1d15 T A 10: 115,220,308 Q253L probably benign Het
Tcf7l1 T A 6: 72,637,051 probably benign Het
Tdrd9 T A 12: 112,042,719 S1020T probably damaging Het
Tead3 A T 17: 28,341,365 D88E probably damaging Het
Tnrc18 A G 5: 142,815,171 S11P probably damaging Homo
Trpc3 G T 3: 36,671,022 D268E probably damaging Het
Ttn A G 2: 76,745,741 V23190A possibly damaging Het
Ubr4 T A 4: 139,408,626 Y908* probably null Het
Urb2 G T 8: 124,030,856 V1101L possibly damaging Het
Usp9y A T Y: 1,341,535 D1375E probably benign Het
Zcchc7 T C 4: 44,895,838 L262P probably damaging Het
Zdhhc7 T A 8: 120,084,900 H188L probably benign Het
Zfp518a T A 19: 40,912,433 C269S probably damaging Het
Zfp933 T C 4: 147,826,774 K90E probably benign Het
Other mutations in Nckipsd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Nckipsd APN 9 108814969 missense probably benign 0.07
IGL01601:Nckipsd APN 9 108813955 missense probably benign 0.00
IGL01809:Nckipsd APN 9 108817554 missense probably damaging 1.00
IGL03229:Nckipsd APN 9 108811614 missense probably benign
R0714:Nckipsd UTSW 9 108814134 unclassified probably benign
R1323:Nckipsd UTSW 9 108812579 missense probably damaging 1.00
R1323:Nckipsd UTSW 9 108812579 missense probably damaging 1.00
R1543:Nckipsd UTSW 9 108812372 missense possibly damaging 0.62
R1958:Nckipsd UTSW 9 108814664 splice site probably null
R2127:Nckipsd UTSW 9 108811733 missense probably benign
R3697:Nckipsd UTSW 9 108811121 missense probably damaging 1.00
R3698:Nckipsd UTSW 9 108811121 missense probably damaging 1.00
R3921:Nckipsd UTSW 9 108814076 missense possibly damaging 0.81
R4755:Nckipsd UTSW 9 108814739 missense probably benign 0.28
R4879:Nckipsd UTSW 9 108813915 unclassified probably benign
R5796:Nckipsd UTSW 9 108811614 missense probably benign
R5943:Nckipsd UTSW 9 108812236 missense possibly damaging 0.54
R5994:Nckipsd UTSW 9 108813977 missense probably benign 0.00
R6144:Nckipsd UTSW 9 108812386 missense probably damaging 1.00
R6403:Nckipsd UTSW 9 108811683 missense possibly damaging 0.71
R7413:Nckipsd UTSW 9 108814081 missense probably benign 0.30
Y4335:Nckipsd UTSW 9 108817545 missense probably damaging 1.00
Z1088:Nckipsd UTSW 9 108814677 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TGAAGGAACTGGAGACTCCCAC -3'
(R):5'- GGTCAGAGTCTCAACCTCCTTG -3'

Sequencing Primer
(F):5'- AATACTGGAGCCGACTCGCTC -3'
(R):5'- TTGTCTGGTAGAAGTCCCGAAGAATC -3'
Posted On2017-02-15