Incidental Mutation 'R5891:Kif13b'
ID457211
Institutional Source Beutler Lab
Gene Symbol Kif13b
Ensembl Gene ENSMUSG00000060012
Gene Namekinesin family member 13B
SynonymsN-3 kinesin, C130021D12Rik, 5330429L19Rik, GAKIN
MMRRC Submission 044092-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5891 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location64647265-64809617 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to G at 64788405 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000153168 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100473] [ENSMUST00000224503]
Predicted Effect probably null
Transcript: ENSMUST00000100473
SMART Domains Protein: ENSMUSP00000098041
Gene: ENSMUSG00000060012

DomainStartEndE-ValueType
KISc 3 361 1.4e-182 SMART
FHA 470 520 6.86e-1 SMART
low complexity region 546 560 N/A INTRINSIC
coiled coil region 617 646 N/A INTRINSIC
coiled coil region 669 701 N/A INTRINSIC
Pfam:KIF1B 756 802 4.1e-20 PFAM
Pfam:DUF3694 1003 1279 1.4e-37 PFAM
low complexity region 1514 1526 N/A INTRINSIC
low complexity region 1532 1548 N/A INTRINSIC
low complexity region 1574 1589 N/A INTRINSIC
low complexity region 1617 1630 N/A INTRINSIC
CAP_GLY 1719 1784 1.54e-29 SMART
low complexity region 1814 1826 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000224503
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224677
Meta Mutation Damage Score 0.6612 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.9%
Validation Efficiency 96% (85/89)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit increased circulating cholesterol and factor VIII levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik A G 15: 8,188,589 I828V probably benign Het
A430105I19Rik T A 2: 118,761,383 D92V probably damaging Het
Abi3bp A T 16: 56,606,133 T504S probably damaging Het
Adamtsl4 C A 3: 95,682,313 R387L possibly damaging Het
Adgb G A 10: 10,377,847 Q1224* probably null Het
Ankrd40 T A 11: 94,334,863 F240Y probably damaging Het
Asnsd1 A T 1: 53,347,977 Y164N probably benign Het
Atf7ip A T 6: 136,559,977 E69D possibly damaging Het
Atm T C 9: 53,497,159 T1129A probably benign Het
AU021092 T C 16: 5,212,131 D340G probably benign Het
Baz2a T A 10: 128,121,322 I978N probably damaging Het
BC034090 T C 1: 155,233,047 probably benign Het
Bcl9 A G 3: 97,208,888 L830P probably damaging Het
Bicral T C 17: 46,801,229 N1015S probably benign Het
Ceacam3 C A 7: 17,151,793 T107N probably damaging Het
Cep83 T C 10: 94,725,675 V109A probably benign Het
Ces1e A G 8: 93,203,266 V463A possibly damaging Het
Ciao1 A G 2: 127,247,134 V55A probably benign Het
Col19a1 T C 1: 24,289,725 E900G probably damaging Het
Commd3 A G 2: 18,673,815 probably benign Het
Coro1c A G 5: 113,850,811 I157T probably damaging Het
Ctso T A 3: 81,954,254 F311L probably benign Het
Cxcl10 A G 5: 92,348,224 probably benign Het
Daam1 C A 12: 71,944,149 T179N unknown Het
Ddx24 T C 12: 103,424,058 K225E probably damaging Het
Dnajc16 T C 4: 141,775,392 T278A probably benign Het
Dnajc2 A T 5: 21,761,711 N345K possibly damaging Het
Dnpep G T 1: 75,311,812 Q395K probably benign Het
Dync1h1 T C 12: 110,614,220 probably null Het
Exoc1 A G 5: 76,542,144 D177G probably damaging Het
Fam135b C T 15: 71,525,803 R136H probably damaging Het
Fam214a C G 9: 75,004,386 C46W probably damaging Het
Filip1 T G 9: 79,819,860 L492F possibly damaging Het
Flvcr2 A T 12: 85,796,228 I359F possibly damaging Het
Gmcl1 A G 6: 86,707,443 W366R probably damaging Het
Htt A G 5: 34,870,823 T1808A possibly damaging Het
Ighv5-4 C A 12: 113,597,629 R57L probably damaging Het
Il12rb2 A T 6: 67,360,690 I69N probably damaging Het
Irf5 A T 6: 29,529,425 probably benign Het
Klkb1 T A 8: 45,270,666 T571S probably benign Het
Mapkbp1 G T 2: 120,023,932 E1337* probably null Het
Met A G 6: 17,491,539 D100G probably benign Het
Mgam T A 6: 40,744,348 D183E probably benign Het
Mrgprb13 T C 7: 48,312,259 noncoding transcript Het
Mrgprx2 T C 7: 48,482,246 T275A probably benign Het
Mroh2a C A 1: 88,241,615 Q671K possibly damaging Het
Nckipsd T A 9: 108,808,609 S42R probably damaging Het
Nlrp12 T A 7: 3,219,259 probably benign Het
Olfr1297 A T 2: 111,621,433 L214M probably damaging Het
Olfr361 T A 2: 37,084,978 M257L probably benign Het
Olfr467 C T 7: 107,815,180 P199S probably damaging Het
Olfr527 C T 7: 140,336,600 T246I probably benign Het
Otoa T A 7: 121,132,360 probably null Het
Pfkm T A 15: 98,122,690 C233* probably null Het
Pikfyve A G 1: 65,202,737 Y212C probably damaging Het
Ptprq T A 10: 107,576,895 D1781V possibly damaging Het
Pttg1ip A G 10: 77,582,440 probably benign Het
Rab6a T A 7: 100,639,247 probably null Het
Rbm11 C T 16: 75,598,837 A132V possibly damaging Het
Sept4 G T 11: 87,588,924 probably benign Het
Serpinb8 A G 1: 107,605,845 E210G probably damaging Het
Sertad2 G A 11: 20,647,884 G27S probably benign Het
Slco5a1 A G 1: 12,990,402 F32L probably benign Het
Smad2 A G 18: 76,299,975 E326G probably damaging Het
Sp9 T A 2: 73,274,251 L383Q probably damaging Het
Stx11 T C 10: 12,941,815 N55S probably damaging Het
Tbc1d15 T A 10: 115,220,308 Q253L probably benign Het
Tcf7l1 T A 6: 72,637,051 probably benign Het
Tdrd9 T A 12: 112,042,719 S1020T probably damaging Het
Tead3 A T 17: 28,341,365 D88E probably damaging Het
Tnrc18 A G 5: 142,815,171 S11P probably damaging Homo
Trpc3 G T 3: 36,671,022 D268E probably damaging Het
Ttn A G 2: 76,745,741 V23190A possibly damaging Het
Ubr4 T A 4: 139,408,626 Y908* probably null Het
Urb2 G T 8: 124,030,856 V1101L possibly damaging Het
Usp9y A T Y: 1,341,535 D1375E probably benign Het
Zcchc7 T C 4: 44,895,838 L262P probably damaging Het
Zdhhc7 T A 8: 120,084,900 H188L probably benign Het
Zfp518a T A 19: 40,912,433 C269S probably damaging Het
Zfp933 T C 4: 147,826,774 K90E probably benign Het
Other mutations in Kif13b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Kif13b APN 14 64669693 missense possibly damaging 0.81
IGL00485:Kif13b APN 14 64765073 missense possibly damaging 0.88
IGL00495:Kif13b APN 14 64714113 missense probably benign 0.07
IGL00556:Kif13b APN 14 64744888 missense probably damaging 1.00
IGL00571:Kif13b APN 14 64746417 missense probably damaging 0.99
IGL00590:Kif13b APN 14 64779462 missense probably damaging 1.00
IGL01650:Kif13b APN 14 64765145 missense probably benign 0.00
IGL01730:Kif13b APN 14 64750361 critical splice donor site probably null
IGL01908:Kif13b APN 14 64757558 missense probably damaging 1.00
IGL02388:Kif13b APN 14 64800358 missense probably damaging 1.00
IGL02573:Kif13b APN 14 64803431 missense probably damaging 1.00
IGL02661:Kif13b APN 14 64767691 missense probably benign 0.06
IGL02794:Kif13b APN 14 64803440 missense probably benign 0.00
IGL02959:Kif13b APN 14 64767717 missense probably damaging 1.00
IGL02979:Kif13b APN 14 64789697 missense probably damaging 0.96
IGL03114:Kif13b APN 14 64788448 missense probably benign 0.00
R0024:Kif13b UTSW 14 64750273 missense probably benign 0.30
R0330:Kif13b UTSW 14 64803220 missense probably benign
R0376:Kif13b UTSW 14 64757404 splice site probably benign
R0571:Kif13b UTSW 14 64751528 missense probably damaging 1.00
R0718:Kif13b UTSW 14 64751662 splice site probably benign
R1144:Kif13b UTSW 14 64714117 missense probably benign 0.01
R1183:Kif13b UTSW 14 64782377 missense probably benign 0.00
R1264:Kif13b UTSW 14 64776232 splice site probably benign
R1497:Kif13b UTSW 14 64736266 missense probably damaging 0.99
R1579:Kif13b UTSW 14 64782341 critical splice acceptor site probably null
R1624:Kif13b UTSW 14 64738619 missense probably damaging 0.99
R1706:Kif13b UTSW 14 64760666 splice site probably benign
R2176:Kif13b UTSW 14 64669671 missense probably benign 0.01
R3727:Kif13b UTSW 14 64765748 splice site probably benign
R3785:Kif13b UTSW 14 64800400 missense probably benign 0.00
R3786:Kif13b UTSW 14 64800400 missense probably benign 0.00
R4088:Kif13b UTSW 14 64767455 critical splice donor site probably null
R4279:Kif13b UTSW 14 64779356 missense probably damaging 1.00
R4559:Kif13b UTSW 14 64806132 missense probably damaging 0.98
R4689:Kif13b UTSW 14 64773064 missense probably damaging 1.00
R4692:Kif13b UTSW 14 64803575 missense probably benign 0.05
R4878:Kif13b UTSW 14 64806154 missense probably benign 0.00
R4971:Kif13b UTSW 14 64757562 missense possibly damaging 0.90
R5037:Kif13b UTSW 14 64758589 nonsense probably null
R5119:Kif13b UTSW 14 64757453 missense probably benign 0.01
R5167:Kif13b UTSW 14 64772935 missense probably damaging 1.00
R5408:Kif13b UTSW 14 64779689 critical splice acceptor site probably null
R5437:Kif13b UTSW 14 64806114 missense probably damaging 0.99
R5756:Kif13b UTSW 14 64736305 missense probably damaging 1.00
R5838:Kif13b UTSW 14 64737555 missense probably damaging 1.00
R6120:Kif13b UTSW 14 64751558 missense probably damaging 1.00
R6150:Kif13b UTSW 14 64751639 missense probably damaging 0.99
R6165:Kif13b UTSW 14 64742311 missense probably damaging 1.00
R6187:Kif13b UTSW 14 64736215 missense probably damaging 1.00
R6229:Kif13b UTSW 14 64738567 missense probably damaging 1.00
R6267:Kif13b UTSW 14 64738634 missense probably damaging 1.00
R6347:Kif13b UTSW 14 64767619 missense probably benign 0.26
R6479:Kif13b UTSW 14 64751525 missense probably benign 0.08
R6512:Kif13b UTSW 14 64744874 critical splice acceptor site probably null
R6851:Kif13b UTSW 14 64773065 missense probably damaging 1.00
R7131:Kif13b UTSW 14 64773068 missense probably damaging 1.00
R7217:Kif13b UTSW 14 64773068 missense probably damaging 1.00
R7398:Kif13b UTSW 14 64757523 missense probably null 0.02
R7427:Kif13b UTSW 14 64788460 missense probably benign
R7428:Kif13b UTSW 14 64788460 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCAGTGAACATTCATCTATGAGG -3'
(R):5'- TGTGGACCTAGCAGGACATTC -3'

Sequencing Primer
(F):5'- TGAACATTCATCTATGAGGGACTC -3'
(R):5'- GACCTAGCAGGACATTCTGATTG -3'
Posted On2017-02-15