Incidental Mutation 'R5892:Dclre1a'
ID457272
Institutional Source Beutler Lab
Gene Symbol Dclre1a
Ensembl Gene ENSMUSG00000025077
Gene NameDNA cross-link repair 1A
Synonyms2810043H12Rik, SMN1a, SNM1, mSNM1
MMRRC Submission 044093-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5892 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location56529167-56548222 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 56547140 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 4 (E4G)
Ref Sequence ENSEMBL: ENSMUSP00000138537 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071423] [ENSMUST00000182059] [ENSMUST00000182276] [ENSMUST00000183143]
Predicted Effect probably benign
Transcript: ENSMUST00000071423
SMART Domains Protein: ENSMUSP00000071370
Gene: ENSMUSG00000025078

DomainStartEndE-ValueType
Pfam:Thioredoxin_8 78 174 2.7e-14 PFAM
LY 216 258 8.44e0 SMART
Pfam:NHL 278 304 2.3e-9 PFAM
low complexity region 321 331 N/A INTRINSIC
Blast:LY 402 446 5e-8 BLAST
LY 467 509 1.91e0 SMART
Pfam:NHL 530 558 1.2e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182058
Predicted Effect probably benign
Transcript: ENSMUST00000182059
AA Change: E4G

PolyPhen 2 Score 0.062 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect probably benign
Transcript: ENSMUST00000182276
AA Change: E4G

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000138290
Gene: ENSMUSG00000025077
AA Change: E4G

DomainStartEndE-ValueType
low complexity region 90 110 N/A INTRINSIC
low complexity region 211 220 N/A INTRINSIC
low complexity region 546 560 N/A INTRINSIC
Lactamase_B 705 853 7.86e-1 SMART
Pfam:DRMBL 921 1027 1e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000183143
AA Change: E4G

PolyPhen 2 Score 0.290 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000138537
Gene: ENSMUSG00000025077
AA Change: E4G

DomainStartEndE-ValueType
low complexity region 90 110 N/A INTRINSIC
Meta Mutation Damage Score 0.1312 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.6%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a conserved protein that is involved in the repair of DNA interstrand cross-links. DNA cross-links suppress transcription, replication, and DNA segregation. The encoded protein is a regulator of the mitotic cell cycle checkpoint. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2012]
PHENOTYPE: Mice homozygous for a targeted null mutation are viable and fertile but exhibit increased sensitivity to the DNA interstrand cross-linking agent mitomycin C. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930524J08Rik G T 5: 99,979,265 probably benign Het
Abcb11 C T 2: 69,261,500 A893T probably damaging Het
Adtrp A T 13: 41,828,206 N30K probably benign Het
Alms1 T A 6: 85,620,903 S904T probably damaging Het
Cep170 T A 1: 176,755,387 probably null Het
Cntnap3 A G 13: 64,799,180 V145A probably damaging Het
Depdc1a G C 3: 159,526,669 A686P probably damaging Het
Dnah7b T C 1: 46,337,593 probably null Het
Enox1 A G 14: 77,486,017 probably benign Het
Fam107b A G 2: 3,778,564 E268G probably damaging Het
Fer1l6 A G 15: 58,564,068 S437G probably benign Het
Flnb C A 14: 7,907,183 T1252K probably damaging Het
Fubp1 A G 3: 152,218,314 probably benign Het
Gm20402 G A 3: 52,268,949 A50T probably benign Het
Gpr137b T C 13: 13,359,406 Y355C probably damaging Het
Gzmk C T 13: 113,173,922 probably null Het
Ino80 A T 2: 119,439,547 probably benign Het
Ints8 T C 4: 11,223,813 T677A probably damaging Het
Kat6a A G 8: 22,938,289 E1220G probably damaging Het
Lrfn5 A G 12: 61,843,418 T498A probably damaging Het
Lrp2 T A 2: 69,442,776 T4043S probably benign Het
Malrd1 A G 2: 15,614,267 N314S probably benign Het
Mfsd1 A G 3: 67,589,829 probably null Het
Muc1 C T 3: 89,230,993 P381S probably benign Het
Myh2 A T 11: 67,185,176 K730* probably null Het
Nat3 T A 8: 67,547,938 N156K probably benign Het
Nelfe T C 17: 34,854,669 probably benign Het
Nlrp1a A T 11: 71,099,645 L927Q probably damaging Het
P4ha2 A G 11: 54,120,188 Y343C probably damaging Het
Pclo A T 5: 14,521,171 Q190L probably damaging Het
Pde8a A G 7: 81,295,691 N183S probably damaging Het
Plekha2 C T 8: 25,052,365 V278I probably benign Het
Plekha6 G C 1: 133,272,307 R208P possibly damaging Het
Plxnb1 T C 9: 109,111,707 L1550P probably damaging Het
Ppox C T 1: 171,277,461 V385I probably damaging Het
Prdm16 T C 4: 154,323,259 D1170G possibly damaging Het
Prmt5 A T 14: 54,509,911 S470T probably damaging Het
Robo2 T A 16: 73,895,780 probably benign Het
Siglecg G A 7: 43,412,204 probably benign Het
Slc30a5 T C 13: 100,813,302 N367S probably damaging Het
Tex29 C T 8: 11,854,288 probably benign Het
Tmem117 T A 15: 94,638,139 V18E probably damaging Het
Tmtc2 C T 10: 105,413,505 M122I probably benign Het
Tpr T A 1: 150,407,400 N287K probably benign Het
Unc93b1 A T 19: 3,943,632 D358V probably damaging Het
Vrk2 A T 11: 26,534,372 probably benign Het
Wdr24 A T 17: 25,827,986 Q671L probably benign Het
Zfp110 C T 7: 12,848,478 T351I probably benign Het
Zfp963 T C 8: 69,743,377 D142G probably benign Het
Other mutations in Dclre1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01655:Dclre1a APN 19 56547057 missense probably damaging 1.00
IGL02113:Dclre1a APN 19 56541532 missense probably damaging 0.98
IGL02264:Dclre1a APN 19 56544293 missense possibly damaging 0.93
IGL03303:Dclre1a APN 19 56546766 missense possibly damaging 0.85
FR4589:Dclre1a UTSW 19 56544123 utr 3 prime probably benign
PIT4377001:Dclre1a UTSW 19 56544405 missense probably benign 0.05
R0081:Dclre1a UTSW 19 56542707 missense probably damaging 1.00
R0355:Dclre1a UTSW 19 56546635 critical splice donor site probably null
R0422:Dclre1a UTSW 19 56544135 nonsense probably null
R0486:Dclre1a UTSW 19 56541490 splice site probably benign
R0619:Dclre1a UTSW 19 56545409 missense probably benign 0.00
R0639:Dclre1a UTSW 19 56538440 missense probably damaging 1.00
R1221:Dclre1a UTSW 19 56531268 missense possibly damaging 0.69
R1352:Dclre1a UTSW 19 56545163 missense probably damaging 1.00
R1824:Dclre1a UTSW 19 56546718 unclassified probably null
R1833:Dclre1a UTSW 19 56541500 splice site probably null
R3851:Dclre1a UTSW 19 56541507 missense probably damaging 1.00
R3889:Dclre1a UTSW 19 56545320 missense probably benign 0.00
R4373:Dclre1a UTSW 19 56545442 missense probably benign 0.04
R5277:Dclre1a UTSW 19 56544732 missense possibly damaging 0.78
R5747:Dclre1a UTSW 19 56541532 missense probably damaging 0.98
R5792:Dclre1a UTSW 19 56529590 missense probably damaging 1.00
R5993:Dclre1a UTSW 19 56542737 missense probably damaging 1.00
R6368:Dclre1a UTSW 19 56546791 missense probably benign 0.02
R6706:Dclre1a UTSW 19 56545069 missense probably benign 0.11
R6944:Dclre1a UTSW 19 56545019 missense possibly damaging 0.90
R6960:Dclre1a UTSW 19 56542709 missense probably damaging 1.00
R7023:Dclre1a UTSW 19 56540206 missense probably damaging 0.99
R7213:Dclre1a UTSW 19 56529635 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGCCTGGATTTTCTGAAGTCC -3'
(R):5'- TAGATGTTACCCTGTAGTGAGTTCTC -3'

Sequencing Primer
(F):5'- CTTTTGACTGGTGTTTTCCATCTG -3'
(R):5'- ATGGAACAGCAGGTGTTC -3'
Posted On2017-02-15