Incidental Mutation 'R5893:Nat10'
ID457282
Institutional Source Beutler Lab
Gene Symbol Nat10
Ensembl Gene ENSMUSG00000027185
Gene NameN-acetyltransferase 10
Synonyms
MMRRC Submission 044094-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5893 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location103721256-103761270 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to C at 103721839 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000075566 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028608] [ENSMUST00000076212]
Predicted Effect unknown
Transcript: ENSMUST00000028608
AA Change: L1020R
SMART Domains Protein: ENSMUSP00000028608
Gene: ENSMUSG00000027185
AA Change: L1020R

DomainStartEndE-ValueType
Pfam:DUF1726 107 201 6.9e-39 PFAM
low complexity region 226 242 N/A INTRINSIC
Pfam:Helicase_RecD 281 488 1.3e-68 PFAM
Pfam:GNAT_acetyltr_2 528 753 7e-103 PFAM
Pfam:tRNA_bind_2 771 892 3.6e-46 PFAM
low complexity region 999 1024 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000076212
SMART Domains Protein: ENSMUSP00000075566
Gene: ENSMUSG00000032724

DomainStartEndE-ValueType
low complexity region 29 48 N/A INTRINSIC
low complexity region 122 143 N/A INTRINSIC
Blast:H2A 186 301 2e-38 BLAST
low complexity region 366 376 N/A INTRINSIC
ANK 521 550 4.78e-7 SMART
ANK 567 596 6.26e-2 SMART
ANK 606 635 3.65e-3 SMART
ANK 649 678 5.52e2 SMART
ANK 715 746 1.84e3 SMART
BTB 844 946 9.15e-24 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131122
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132135
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133016
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137050
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138580
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143017
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144590
Meta Mutation Damage Score 0.082 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency 95% (73/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an RNA cytidine acetyltransferase involved in histone acetylation, tRNA acetylation, the biosynthesis of 18S rRNA, and the enhancement of nuclear architecture and chromatin organization. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 T A 19: 57,215,853 R35S probably benign Het
Acacb A T 5: 114,229,851 I1637F probably benign Het
Adamts18 A T 8: 113,773,077 C402S probably damaging Het
Adra2b T A 2: 127,364,482 D306E probably benign Het
Ammecr1l C T 18: 31,778,920 T263I probably damaging Het
Antxr1 T C 6: 87,137,259 I509V probably benign Het
Bahcc1 A G 11: 120,285,430 E1967G probably damaging Het
Brap T A 5: 121,679,342 Y337* probably null Het
Brca2 T C 5: 150,569,138 V3206A probably benign Het
C330027C09Rik A G 16: 48,997,500 S78G probably benign Het
Cacna1e A T 1: 154,437,323 F1486I probably damaging Het
Cbx4 A G 11: 119,082,190 Y120H probably damaging Het
Ccar2 T A 14: 70,151,351 Q137L probably benign Het
Ceacam12 A G 7: 18,069,374 D235G probably damaging Het
Celsr1 A G 15: 85,904,014 V2679A probably benign Het
Champ1 C T 8: 13,878,777 P312S probably benign Het
Chst5 A G 8: 111,890,196 L264S probably damaging Het
Colec10 T A 15: 54,410,789 F4L probably benign Het
Cyp2a4 G A 7: 26,308,928 G165D probably damaging Het
Cyp2c29 G C 19: 39,330,389 A438P possibly damaging Het
Dlat A G 9: 50,644,139 probably benign Het
Dmxl2 A G 9: 54,387,420 V2457A possibly damaging Het
Dnah7a A G 1: 53,457,785 M3104T possibly damaging Het
Dock8 C T 19: 25,122,447 H645Y probably damaging Het
Ehbp1l1 T C 19: 5,718,431 E948G probably benign Het
Eps8l2 C T 7: 141,357,624 R384C probably damaging Het
Fam174a A T 1: 95,325,159 N162I probably damaging Het
Fbp2 T A 13: 62,837,102 N335I probably benign Het
Foxred2 C A 15: 77,947,144 G490C probably damaging Het
Fyttd1 T G 16: 32,898,913 D200E probably damaging Het
Gdf15 A T 8: 70,629,823 V211E possibly damaging Het
Gm13084 T A 4: 143,810,468 Y431F probably damaging Het
Gm13178 C T 4: 144,703,196 V408I probably benign Het
Gm5065 A T 7: 5,359,624 T85S probably benign Het
Gm6214 A G 3: 140,839,346 noncoding transcript Het
Havcr2 A G 11: 46,456,316 Y40C probably damaging Het
Htra1 T G 7: 130,961,591 V184G probably damaging Het
Hydin A T 8: 110,490,676 I1399F probably benign Het
Igtp T C 11: 58,206,648 L215P probably damaging Het
Kctd1 T C 18: 14,969,688 E812G possibly damaging Het
Lap3 T C 5: 45,511,279 probably benign Het
Lrp1b C A 2: 40,601,587 A223S probably damaging Het
Mtnr1b A T 9: 15,863,244 V173E probably damaging Het
Ndfip2 T A 14: 105,294,857 V229E probably damaging Het
Nefh G A 11: 4,941,323 T432M probably damaging Het
Nfe2l3 A G 6: 51,457,852 Y464C probably damaging Het
Nrip1 C A 16: 76,293,953 A239S probably damaging Het
Olfml2b A G 1: 170,662,473 S221G probably benign Het
Orc4 G T 2: 48,905,547 S389* probably null Het
P4hb A G 11: 120,571,650 S77P probably damaging Het
Pcyt2 T C 11: 120,617,797 probably null Het
Plagl1 T C 10: 13,128,194 probably benign Het
Poglut1 C T 16: 38,529,595 R272Q probably damaging Het
Rdh5 T C 10: 128,914,221 probably null Het
Rogdi A T 16: 5,013,394 L3* probably null Het
Skap1 T C 11: 96,581,398 *166Q probably null Het
Slc38a4 A G 15: 96,999,551 I461T probably benign Het
Snx31 A C 15: 36,523,455 I360M probably damaging Het
Spata22 A T 11: 73,336,247 K96* probably null Het
Strn3 A T 12: 51,643,223 probably null Het
Trip12 A C 1: 84,759,163 probably benign Het
Uggt1 A T 1: 36,227,628 probably null Het
Upk3a A C 15: 85,019,337 D79A probably damaging Het
Uts2r A T 11: 121,161,279 Y323F probably benign Het
Vmn2r1 A T 3: 64,086,553 N107Y probably damaging Het
Vps13c A T 9: 67,902,839 probably null Het
Wnt7b A G 15: 85,581,374 probably benign Het
Zfp410 T A 12: 84,337,611 probably null Het
Other mutations in Nat10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00570:Nat10 APN 2 103725764 critical splice acceptor site probably null
IGL01062:Nat10 APN 2 103743048 missense probably damaging 1.00
IGL01524:Nat10 APN 2 103757757 missense probably damaging 1.00
IGL02553:Nat10 APN 2 103752668 missense probably damaging 1.00
IGL03040:Nat10 APN 2 103757265 splice site probably benign
R0106:Nat10 UTSW 2 103757205 missense probably damaging 1.00
R0106:Nat10 UTSW 2 103757205 missense probably damaging 1.00
R0268:Nat10 UTSW 2 103727917 splice site probably benign
R0422:Nat10 UTSW 2 103726729 nonsense probably null
R0423:Nat10 UTSW 2 103748227 missense probably damaging 0.98
R0788:Nat10 UTSW 2 103743115 missense probably damaging 1.00
R0946:Nat10 UTSW 2 103731374 missense probably damaging 0.99
R1353:Nat10 UTSW 2 103754073 missense possibly damaging 0.95
R2141:Nat10 UTSW 2 103731303 splice site probably null
R2142:Nat10 UTSW 2 103731303 splice site probably null
R2192:Nat10 UTSW 2 103726177 missense probably benign 0.00
R3904:Nat10 UTSW 2 103726247 splice site probably benign
R4183:Nat10 UTSW 2 103739813 missense probably damaging 1.00
R4496:Nat10 UTSW 2 103757739 missense probably damaging 1.00
R4578:Nat10 UTSW 2 103754072 missense probably damaging 1.00
R4589:Nat10 UTSW 2 103754070 missense probably damaging 1.00
R4639:Nat10 UTSW 2 103734889 missense probably benign 0.00
R4679:Nat10 UTSW 2 103732170 missense probably damaging 1.00
R4711:Nat10 UTSW 2 103748267 nonsense probably null
R5089:Nat10 UTSW 2 103757143 unclassified probably benign
R5103:Nat10 UTSW 2 103757260 missense probably damaging 0.97
R5108:Nat10 UTSW 2 103732203 missense probably damaging 0.97
R5134:Nat10 UTSW 2 103743293 missense probably benign 0.29
R5823:Nat10 UTSW 2 103730267 missense probably damaging 1.00
R6135:Nat10 UTSW 2 103743316 missense probably damaging 1.00
R6455:Nat10 UTSW 2 103739886 missense possibly damaging 0.69
R6592:Nat10 UTSW 2 103754150 missense probably null 1.00
R6956:Nat10 UTSW 2 103734412 missense probably benign 0.01
R7036:Nat10 UTSW 2 103754108 missense probably benign 0.00
R7063:Nat10 UTSW 2 103748077 missense probably benign 0.01
R7172:Nat10 UTSW 2 103732969 missense probably damaging 1.00
R7226:Nat10 UTSW 2 103726753 missense probably benign 0.01
R7286:Nat10 UTSW 2 103754169 missense probably benign 0.02
R7448:Nat10 UTSW 2 103748045 missense probably damaging 0.99
R7470:Nat10 UTSW 2 103734881 missense probably benign 0.00
X0024:Nat10 UTSW 2 103727881 missense possibly damaging 0.49
Predicted Primers PCR Primer
(F):5'- AGCAGCCTGTTCAAGAGTG -3'
(R):5'- GCAGAGAACATGTCTGGGTG -3'

Sequencing Primer
(F):5'- CAAGAGTGACTTTGTCTTCAGTCACG -3'
(R):5'- AGGGTGGTTCTTCAAATAGCAGC -3'
Posted On2017-02-15