Incidental Mutation 'R5893:Eps8l2'
ID457299
Institutional Source Beutler Lab
Gene Symbol Eps8l2
Ensembl Gene ENSMUSG00000025504
Gene NameEPS8-like 2
Synonyms
MMRRC Submission 044094-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5893 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location141338880-141363020 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 141357624 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 384 (R384C)
Ref Sequence ENSEMBL: ENSMUSP00000026577 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026577] [ENSMUST00000143633]
Predicted Effect probably damaging
Transcript: ENSMUST00000026577
AA Change: R384C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000026577
Gene: ENSMUSG00000025504
AA Change: R384C

DomainStartEndE-ValueType
Pfam:PTB 51 181 6.6e-50 PFAM
Pfam:PID 52 175 5.9e-9 PFAM
low complexity region 196 209 N/A INTRINSIC
low complexity region 284 299 N/A INTRINSIC
SH3 498 553 2.11e-15 SMART
PDB:1WWU|A 614 700 2e-46 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127501
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129373
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133669
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134845
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136240
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136736
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140025
Predicted Effect probably benign
Transcript: ENSMUST00000143633
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145108
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146042
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155729
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210158
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency 95% (73/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the EPS8 gene family. The encoded protein, like other members of the family, is thought to link growth factor stimulation to actin organization, generating functional redundancy in the pathways that regulate actin cytoskeletal remodeling. [provided by RefSeq, Dec 2008]
PHENOTYPE: Mice homozygous for a null mutation display late onset progressive hearing loss and gradual deterioration of cochlear hair cell stereocilliary bundles. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 T A 19: 57,215,853 R35S probably benign Het
Acacb A T 5: 114,229,851 I1637F probably benign Het
Adamts18 A T 8: 113,773,077 C402S probably damaging Het
Adra2b T A 2: 127,364,482 D306E probably benign Het
Ammecr1l C T 18: 31,778,920 T263I probably damaging Het
Antxr1 T C 6: 87,137,259 I509V probably benign Het
Bahcc1 A G 11: 120,285,430 E1967G probably damaging Het
Brap T A 5: 121,679,342 Y337* probably null Het
Brca2 T C 5: 150,569,138 V3206A probably benign Het
C330027C09Rik A G 16: 48,997,500 S78G probably benign Het
Cacna1e A T 1: 154,437,323 F1486I probably damaging Het
Cbx4 A G 11: 119,082,190 Y120H probably damaging Het
Ccar2 T A 14: 70,151,351 Q137L probably benign Het
Ceacam12 A G 7: 18,069,374 D235G probably damaging Het
Celsr1 A G 15: 85,904,014 V2679A probably benign Het
Champ1 C T 8: 13,878,777 P312S probably benign Het
Chst5 A G 8: 111,890,196 L264S probably damaging Het
Colec10 T A 15: 54,410,789 F4L probably benign Het
Cyp2a4 G A 7: 26,308,928 G165D probably damaging Het
Cyp2c29 G C 19: 39,330,389 A438P possibly damaging Het
Dlat A G 9: 50,644,139 probably benign Het
Dmxl2 A G 9: 54,387,420 V2457A possibly damaging Het
Dnah7a A G 1: 53,457,785 M3104T possibly damaging Het
Dock8 C T 19: 25,122,447 H645Y probably damaging Het
Ehbp1l1 T C 19: 5,718,431 E948G probably benign Het
Fam174a A T 1: 95,325,159 N162I probably damaging Het
Fbp2 T A 13: 62,837,102 N335I probably benign Het
Foxred2 C A 15: 77,947,144 G490C probably damaging Het
Fyttd1 T G 16: 32,898,913 D200E probably damaging Het
Gdf15 A T 8: 70,629,823 V211E possibly damaging Het
Gm13084 T A 4: 143,810,468 Y431F probably damaging Het
Gm13178 C T 4: 144,703,196 V408I probably benign Het
Gm5065 A T 7: 5,359,624 T85S probably benign Het
Gm6214 A G 3: 140,839,346 noncoding transcript Het
Havcr2 A G 11: 46,456,316 Y40C probably damaging Het
Htra1 T G 7: 130,961,591 V184G probably damaging Het
Hydin A T 8: 110,490,676 I1399F probably benign Het
Igtp T C 11: 58,206,648 L215P probably damaging Het
Kctd1 T C 18: 14,969,688 E812G possibly damaging Het
Lap3 T C 5: 45,511,279 probably benign Het
Lrp1b C A 2: 40,601,587 A223S probably damaging Het
Mtnr1b A T 9: 15,863,244 V173E probably damaging Het
Nat10 A C 2: 103,721,839 probably benign Het
Ndfip2 T A 14: 105,294,857 V229E probably damaging Het
Nefh G A 11: 4,941,323 T432M probably damaging Het
Nfe2l3 A G 6: 51,457,852 Y464C probably damaging Het
Nrip1 C A 16: 76,293,953 A239S probably damaging Het
Olfml2b A G 1: 170,662,473 S221G probably benign Het
Orc4 G T 2: 48,905,547 S389* probably null Het
P4hb A G 11: 120,571,650 S77P probably damaging Het
Pcyt2 T C 11: 120,617,797 probably null Het
Plagl1 T C 10: 13,128,194 probably benign Het
Poglut1 C T 16: 38,529,595 R272Q probably damaging Het
Rdh5 T C 10: 128,914,221 probably null Het
Rogdi A T 16: 5,013,394 L3* probably null Het
Skap1 T C 11: 96,581,398 *166Q probably null Het
Slc38a4 A G 15: 96,999,551 I461T probably benign Het
Snx31 A C 15: 36,523,455 I360M probably damaging Het
Spata22 A T 11: 73,336,247 K96* probably null Het
Strn3 A T 12: 51,643,223 probably null Het
Trip12 A C 1: 84,759,163 probably benign Het
Uggt1 A T 1: 36,227,628 probably null Het
Upk3a A C 15: 85,019,337 D79A probably damaging Het
Uts2r A T 11: 121,161,279 Y323F probably benign Het
Vmn2r1 A T 3: 64,086,553 N107Y probably damaging Het
Vps13c A T 9: 67,902,839 probably null Het
Wnt7b A G 15: 85,581,374 probably benign Het
Zfp410 T A 12: 84,337,611 probably null Het
Other mutations in Eps8l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01420:Eps8l2 APN 7 141357663 missense probably benign 0.06
IGL01444:Eps8l2 APN 7 141361375 splice site probably benign
IGL01467:Eps8l2 APN 7 141361601 missense probably damaging 1.00
IGL01803:Eps8l2 APN 7 141358230 missense probably benign
IGL02598:Eps8l2 APN 7 141354936 splice site probably benign
IGL02823:Eps8l2 APN 7 141342075 missense probably damaging 1.00
IGL03061:Eps8l2 APN 7 141357235 unclassified probably benign
IGL03112:Eps8l2 APN 7 141361736 missense probably damaging 1.00
IGL03251:Eps8l2 APN 7 141342962 missense probably damaging 1.00
R0057:Eps8l2 UTSW 7 141342971 missense probably benign 0.08
R0133:Eps8l2 UTSW 7 141362207 missense unknown
R0361:Eps8l2 UTSW 7 141356199 missense probably benign 0.05
R0409:Eps8l2 UTSW 7 141342980 missense probably damaging 1.00
R0611:Eps8l2 UTSW 7 141355733 missense probably damaging 1.00
R1487:Eps8l2 UTSW 7 141361618 missense probably benign
R1679:Eps8l2 UTSW 7 141361057 missense probably damaging 1.00
R1914:Eps8l2 UTSW 7 141361852 missense probably damaging 1.00
R1915:Eps8l2 UTSW 7 141361852 missense probably damaging 1.00
R1918:Eps8l2 UTSW 7 141361724 missense probably damaging 0.99
R2098:Eps8l2 UTSW 7 141355792 unclassified probably null
R2170:Eps8l2 UTSW 7 141342071 missense probably benign 0.02
R3429:Eps8l2 UTSW 7 141357919 critical splice donor site probably null
R3734:Eps8l2 UTSW 7 141357821 missense probably damaging 1.00
R4296:Eps8l2 UTSW 7 141358262 nonsense probably null
R4701:Eps8l2 UTSW 7 141357260 missense probably damaging 1.00
R4758:Eps8l2 UTSW 7 141360373 missense probably damaging 0.98
R5564:Eps8l2 UTSW 7 141356621 missense possibly damaging 0.94
R5567:Eps8l2 UTSW 7 141355007 missense possibly damaging 0.95
R5570:Eps8l2 UTSW 7 141355007 missense possibly damaging 0.95
R5735:Eps8l2 UTSW 7 141360377 missense probably damaging 1.00
R5905:Eps8l2 UTSW 7 141357833 missense possibly damaging 0.89
R5927:Eps8l2 UTSW 7 141356346 missense probably benign
R6028:Eps8l2 UTSW 7 141357833 missense possibly damaging 0.89
R6248:Eps8l2 UTSW 7 141342102 missense probably damaging 0.99
R6631:Eps8l2 UTSW 7 141356202 missense probably damaging 1.00
R7152:Eps8l2 UTSW 7 141355765 missense possibly damaging 0.95
R7231:Eps8l2 UTSW 7 141360392 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGCCCACCTTAGCATACTCAAG -3'
(R):5'- CCATTCAGAGCTGTGGTCAG -3'

Sequencing Primer
(F):5'- AGCATACTCAAGCTCTGTCTGGG -3'
(R):5'- TCAGCAGCCAGAAGGTCAGTC -3'
Posted On2017-02-15