Incidental Mutation 'R5893:Adamts18'
ID457305
Institutional Source Beutler Lab
Gene Symbol Adamts18
Ensembl Gene ENSMUSG00000053399
Gene Namea disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 18
SynonymsE130314N14Rik
MMRRC Submission 044094-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.181) question?
Stock #R5893 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location113697126-113848738 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 113773077 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 402 (C402S)
Ref Sequence ENSEMBL: ENSMUSP00000090801 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093113] [ENSMUST00000212665]
Predicted Effect probably damaging
Transcript: ENSMUST00000093113
AA Change: C402S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000090801
Gene: ENSMUSG00000053399
AA Change: C402S

DomainStartEndE-ValueType
signal peptide 1 47 N/A INTRINSIC
Pfam:Pep_M12B_propep 63 203 3.4e-37 PFAM
Pfam:Reprolysin_5 292 473 1.3e-14 PFAM
Pfam:Reprolysin_4 294 494 2.6e-11 PFAM
Pfam:Reprolysin 294 498 2.7e-30 PFAM
Pfam:Reprolysin_2 311 488 1.7e-14 PFAM
Pfam:Reprolysin_3 315 447 1.5e-11 PFAM
TSP1 592 644 7.37e-17 SMART
Pfam:ADAM_spacer1 749 861 1.7e-38 PFAM
TSP1 878 932 1.55e-1 SMART
TSP1 934 992 5.07e-6 SMART
TSP1 994 1049 1.65e-5 SMART
TSP1 1055 1116 1.71e-3 SMART
TSP1 1125 1171 5.27e-4 SMART
Pfam:PLAC 1186 1216 1.2e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000212437
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212527
Predicted Effect probably benign
Transcript: ENSMUST00000212665
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213061
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213076
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213078
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency 95% (73/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) protein family. ADAMTS family members share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The encoded preproprotein is proteolytically processed to generate the mature protein, which may regulate hemostatic balance and function as a tumor suppressor. Mutations in this gene may be associated with microcornea, myopic chorioretinal atrophy, and telecanthus (MMCAT) and cone-rod dystrophy in human patients. [provided by RefSeq, May 2016]
PHENOTYPE: Mice homozygous for a floxed allele exhibit some fertility defects. Mice homozygous for a null allele exhibit growth and eye defects and increased susceptibility to chemically induced tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 T A 19: 57,215,853 R35S probably benign Het
Acacb A T 5: 114,229,851 I1637F probably benign Het
Adra2b T A 2: 127,364,482 D306E probably benign Het
Ammecr1l C T 18: 31,778,920 T263I probably damaging Het
Antxr1 T C 6: 87,137,259 I509V probably benign Het
Bahcc1 A G 11: 120,285,430 E1967G probably damaging Het
Brap T A 5: 121,679,342 Y337* probably null Het
Brca2 T C 5: 150,569,138 V3206A probably benign Het
C330027C09Rik A G 16: 48,997,500 S78G probably benign Het
Cacna1e A T 1: 154,437,323 F1486I probably damaging Het
Cbx4 A G 11: 119,082,190 Y120H probably damaging Het
Ccar2 T A 14: 70,151,351 Q137L probably benign Het
Ceacam12 A G 7: 18,069,374 D235G probably damaging Het
Celsr1 A G 15: 85,904,014 V2679A probably benign Het
Champ1 C T 8: 13,878,777 P312S probably benign Het
Chst5 A G 8: 111,890,196 L264S probably damaging Het
Colec10 T A 15: 54,410,789 F4L probably benign Het
Cyp2a4 G A 7: 26,308,928 G165D probably damaging Het
Cyp2c29 G C 19: 39,330,389 A438P possibly damaging Het
Dlat A G 9: 50,644,139 probably benign Het
Dmxl2 A G 9: 54,387,420 V2457A possibly damaging Het
Dnah7a A G 1: 53,457,785 M3104T possibly damaging Het
Dock8 C T 19: 25,122,447 H645Y probably damaging Het
Ehbp1l1 T C 19: 5,718,431 E948G probably benign Het
Eps8l2 C T 7: 141,357,624 R384C probably damaging Het
Fam174a A T 1: 95,325,159 N162I probably damaging Het
Fbp2 T A 13: 62,837,102 N335I probably benign Het
Foxred2 C A 15: 77,947,144 G490C probably damaging Het
Fyttd1 T G 16: 32,898,913 D200E probably damaging Het
Gdf15 A T 8: 70,629,823 V211E possibly damaging Het
Gm13084 T A 4: 143,810,468 Y431F probably damaging Het
Gm13178 C T 4: 144,703,196 V408I probably benign Het
Gm5065 A T 7: 5,359,624 T85S probably benign Het
Gm6214 A G 3: 140,839,346 noncoding transcript Het
Havcr2 A G 11: 46,456,316 Y40C probably damaging Het
Htra1 T G 7: 130,961,591 V184G probably damaging Het
Hydin A T 8: 110,490,676 I1399F probably benign Het
Igtp T C 11: 58,206,648 L215P probably damaging Het
Kctd1 T C 18: 14,969,688 E812G possibly damaging Het
Lap3 T C 5: 45,511,279 probably benign Het
Lrp1b C A 2: 40,601,587 A223S probably damaging Het
Mtnr1b A T 9: 15,863,244 V173E probably damaging Het
Nat10 A C 2: 103,721,839 probably benign Het
Ndfip2 T A 14: 105,294,857 V229E probably damaging Het
Nefh G A 11: 4,941,323 T432M probably damaging Het
Nfe2l3 A G 6: 51,457,852 Y464C probably damaging Het
Nrip1 C A 16: 76,293,953 A239S probably damaging Het
Olfml2b A G 1: 170,662,473 S221G probably benign Het
Orc4 G T 2: 48,905,547 S389* probably null Het
P4hb A G 11: 120,571,650 S77P probably damaging Het
Pcyt2 T C 11: 120,617,797 probably null Het
Plagl1 T C 10: 13,128,194 probably benign Het
Poglut1 C T 16: 38,529,595 R272Q probably damaging Het
Rdh5 T C 10: 128,914,221 probably null Het
Rogdi A T 16: 5,013,394 L3* probably null Het
Skap1 T C 11: 96,581,398 *166Q probably null Het
Slc38a4 A G 15: 96,999,551 I461T probably benign Het
Snx31 A C 15: 36,523,455 I360M probably damaging Het
Spata22 A T 11: 73,336,247 K96* probably null Het
Strn3 A T 12: 51,643,223 probably null Het
Trip12 A C 1: 84,759,163 probably benign Het
Uggt1 A T 1: 36,227,628 probably null Het
Upk3a A C 15: 85,019,337 D79A probably damaging Het
Uts2r A T 11: 121,161,279 Y323F probably benign Het
Vmn2r1 A T 3: 64,086,553 N107Y probably damaging Het
Vps13c A T 9: 67,902,839 probably null Het
Wnt7b A G 15: 85,581,374 probably benign Het
Zfp410 T A 12: 84,337,611 probably null Het
Other mutations in Adamts18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01290:Adamts18 APN 8 113774943 missense probably damaging 1.00
IGL01548:Adamts18 APN 8 113764299 missense probably damaging 1.00
IGL01556:Adamts18 APN 8 113845109 missense probably benign 0.01
IGL01833:Adamts18 APN 8 113743096 missense probably benign 0.10
IGL02187:Adamts18 APN 8 113713194 missense possibly damaging 0.93
IGL02551:Adamts18 APN 8 113699072 missense probably damaging 1.00
IGL02756:Adamts18 APN 8 113714344 splice site probably benign
IGL03188:Adamts18 APN 8 113699024 missense probably damaging 1.00
IGL03411:Adamts18 APN 8 113764297 nonsense probably null
R0119:Adamts18 UTSW 8 113774953 missense possibly damaging 0.94
R0378:Adamts18 UTSW 8 113743117 missense probably damaging 1.00
R0410:Adamts18 UTSW 8 113714358 nonsense probably null
R0480:Adamts18 UTSW 8 113738818 missense possibly damaging 0.93
R0514:Adamts18 UTSW 8 113738769 intron probably null
R0924:Adamts18 UTSW 8 113705396 splice site probably null
R0930:Adamts18 UTSW 8 113705396 splice site probably null
R1333:Adamts18 UTSW 8 113705173 splice site probably benign
R1441:Adamts18 UTSW 8 113754562 critical splice donor site probably null
R2082:Adamts18 UTSW 8 113775333 missense probably damaging 1.00
R2146:Adamts18 UTSW 8 113845003 missense possibly damaging 0.58
R2371:Adamts18 UTSW 8 113705261 missense probably benign 0.36
R3148:Adamts18 UTSW 8 113738858 missense probably damaging 1.00
R3963:Adamts18 UTSW 8 113777811 missense probably benign 0.00
R4056:Adamts18 UTSW 8 113737580 nonsense probably null
R4486:Adamts18 UTSW 8 113713193 missense probably benign 0.00
R4608:Adamts18 UTSW 8 113737613 missense probably damaging 1.00
R4624:Adamts18 UTSW 8 113773168 nonsense probably null
R4626:Adamts18 UTSW 8 113773168 nonsense probably null
R4627:Adamts18 UTSW 8 113773168 nonsense probably null
R4628:Adamts18 UTSW 8 113773168 nonsense probably null
R4629:Adamts18 UTSW 8 113773168 nonsense probably null
R4710:Adamts18 UTSW 8 113706926 missense probably damaging 0.98
R4959:Adamts18 UTSW 8 113736725 nonsense probably null
R4973:Adamts18 UTSW 8 113736725 nonsense probably null
R4976:Adamts18 UTSW 8 113699010 missense probably benign 0.31
R5119:Adamts18 UTSW 8 113699010 missense probably benign 0.31
R5141:Adamts18 UTSW 8 113775270 missense probably damaging 1.00
R5422:Adamts18 UTSW 8 113698974 missense probably benign 0.06
R5587:Adamts18 UTSW 8 113775360 nonsense probably null
R5868:Adamts18 UTSW 8 113777748 missense possibly damaging 0.69
R5906:Adamts18 UTSW 8 113709619 missense probably benign 0.00
R5942:Adamts18 UTSW 8 113777748 missense probably benign 0.01
R6006:Adamts18 UTSW 8 113706974 missense probably damaging 1.00
R6608:Adamts18 UTSW 8 113775279 missense probably damaging 1.00
R6725:Adamts18 UTSW 8 113743201 missense probably damaging 1.00
R7002:Adamts18 UTSW 8 113775290 missense possibly damaging 0.69
R7276:Adamts18 UTSW 8 113775264 missense probably damaging 0.99
R7292:Adamts18 UTSW 8 113709645 missense probably benign 0.00
Z1088:Adamts18 UTSW 8 113775440 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- GTAACACGGTTCTCAGAATGTGTG -3'
(R):5'- TGCCTCCACAGCTACAAAGG -3'

Sequencing Primer
(F):5'- CTCAGAATGTGTGATTGGGAAC -3'
(R):5'- GGCACAATCATCACTCTTTAATCC -3'
Posted On2017-02-15