Incidental Mutation 'R5893:Kctd1'
ID457340
Institutional Source Beutler Lab
Gene Symbol Kctd1
Ensembl Gene ENSMUSG00000036225
Gene Namepotassium channel tetramerisation domain containing 1
Synonyms
MMRRC Submission 044094-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5893 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location14968685-15151446 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 14969688 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 812 (E812G)
Ref Sequence ENSEMBL: ENSMUSP00000128070 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025992] [ENSMUST00000168989]
Predicted Effect probably benign
Transcript: ENSMUST00000025992
AA Change: E216G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000025992
Gene: ENSMUSG00000036225
AA Change: E216G

DomainStartEndE-ValueType
BTB 38 140 5e-7 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000168989
AA Change: E812G

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000128070
Gene: ENSMUSG00000036225
AA Change: E812G

DomainStartEndE-ValueType
low complexity region 14 44 N/A INTRINSIC
low complexity region 52 62 N/A INTRINSIC
low complexity region 70 101 N/A INTRINSIC
low complexity region 124 145 N/A INTRINSIC
low complexity region 217 234 N/A INTRINSIC
Pfam:DUF3504 278 435 2.6e-32 PFAM
low complexity region 482 503 N/A INTRINSIC
low complexity region 559 567 N/A INTRINSIC
BTB 634 736 5e-7 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency 95% (73/77)
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 T A 19: 57,215,853 R35S probably benign Het
Acacb A T 5: 114,229,851 I1637F probably benign Het
Adamts18 A T 8: 113,773,077 C402S probably damaging Het
Adra2b T A 2: 127,364,482 D306E probably benign Het
Ammecr1l C T 18: 31,778,920 T263I probably damaging Het
Antxr1 T C 6: 87,137,259 I509V probably benign Het
Bahcc1 A G 11: 120,285,430 E1967G probably damaging Het
Brap T A 5: 121,679,342 Y337* probably null Het
Brca2 T C 5: 150,569,138 V3206A probably benign Het
C330027C09Rik A G 16: 48,997,500 S78G probably benign Het
Cacna1e A T 1: 154,437,323 F1486I probably damaging Het
Cbx4 A G 11: 119,082,190 Y120H probably damaging Het
Ccar2 T A 14: 70,151,351 Q137L probably benign Het
Ceacam12 A G 7: 18,069,374 D235G probably damaging Het
Celsr1 A G 15: 85,904,014 V2679A probably benign Het
Champ1 C T 8: 13,878,777 P312S probably benign Het
Chst5 A G 8: 111,890,196 L264S probably damaging Het
Colec10 T A 15: 54,410,789 F4L probably benign Het
Cyp2a4 G A 7: 26,308,928 G165D probably damaging Het
Cyp2c29 G C 19: 39,330,389 A438P possibly damaging Het
Dlat A G 9: 50,644,139 probably benign Het
Dmxl2 A G 9: 54,387,420 V2457A possibly damaging Het
Dnah7a A G 1: 53,457,785 M3104T possibly damaging Het
Dock8 C T 19: 25,122,447 H645Y probably damaging Het
Ehbp1l1 T C 19: 5,718,431 E948G probably benign Het
Eps8l2 C T 7: 141,357,624 R384C probably damaging Het
Fam174a A T 1: 95,325,159 N162I probably damaging Het
Fbp2 T A 13: 62,837,102 N335I probably benign Het
Foxred2 C A 15: 77,947,144 G490C probably damaging Het
Fyttd1 T G 16: 32,898,913 D200E probably damaging Het
Gdf15 A T 8: 70,629,823 V211E possibly damaging Het
Gm13084 T A 4: 143,810,468 Y431F probably damaging Het
Gm13178 C T 4: 144,703,196 V408I probably benign Het
Gm5065 A T 7: 5,359,624 T85S probably benign Het
Gm6214 A G 3: 140,839,346 noncoding transcript Het
Havcr2 A G 11: 46,456,316 Y40C probably damaging Het
Htra1 T G 7: 130,961,591 V184G probably damaging Het
Hydin A T 8: 110,490,676 I1399F probably benign Het
Igtp T C 11: 58,206,648 L215P probably damaging Het
Lap3 T C 5: 45,511,279 probably benign Het
Lrp1b C A 2: 40,601,587 A223S probably damaging Het
Mtnr1b A T 9: 15,863,244 V173E probably damaging Het
Nat10 A C 2: 103,721,839 probably benign Het
Ndfip2 T A 14: 105,294,857 V229E probably damaging Het
Nefh G A 11: 4,941,323 T432M probably damaging Het
Nfe2l3 A G 6: 51,457,852 Y464C probably damaging Het
Nrip1 C A 16: 76,293,953 A239S probably damaging Het
Olfml2b A G 1: 170,662,473 S221G probably benign Het
Orc4 G T 2: 48,905,547 S389* probably null Het
P4hb A G 11: 120,571,650 S77P probably damaging Het
Pcyt2 T C 11: 120,617,797 probably null Het
Plagl1 T C 10: 13,128,194 probably benign Het
Poglut1 C T 16: 38,529,595 R272Q probably damaging Het
Rdh5 T C 10: 128,914,221 probably null Het
Rogdi A T 16: 5,013,394 L3* probably null Het
Skap1 T C 11: 96,581,398 *166Q probably null Het
Slc38a4 A G 15: 96,999,551 I461T probably benign Het
Snx31 A C 15: 36,523,455 I360M probably damaging Het
Spata22 A T 11: 73,336,247 K96* probably null Het
Strn3 A T 12: 51,643,223 probably null Het
Trip12 A C 1: 84,759,163 probably benign Het
Uggt1 A T 1: 36,227,628 probably null Het
Upk3a A C 15: 85,019,337 D79A probably damaging Het
Uts2r A T 11: 121,161,279 Y323F probably benign Het
Vmn2r1 A T 3: 64,086,553 N107Y probably damaging Het
Vps13c A T 9: 67,902,839 probably null Het
Wnt7b A G 15: 85,581,374 probably benign Het
Zfp410 T A 12: 84,337,611 probably null Het
Other mutations in Kctd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01318:Kctd1 APN 18 15062690 missense possibly damaging 0.51
IGL01402:Kctd1 APN 18 14969553 missense probably damaging 0.98
IGL01404:Kctd1 APN 18 14969553 missense probably damaging 0.98
IGL01755:Kctd1 APN 18 15062637 missense possibly damaging 0.86
IGL02606:Kctd1 APN 18 15062880 missense possibly damaging 0.73
IGL02725:Kctd1 APN 18 14969610 missense possibly damaging 0.67
IGL02946:Kctd1 APN 18 14973979 critical splice donor site probably null
R0128:Kctd1 UTSW 18 14974180 missense probably benign 0.00
R0598:Kctd1 UTSW 18 15007765 missense probably damaging 1.00
R1398:Kctd1 UTSW 18 15062597 missense possibly damaging 0.85
R1669:Kctd1 UTSW 18 15062460 missense possibly damaging 0.71
R1701:Kctd1 UTSW 18 14969560 missense possibly damaging 0.95
R1745:Kctd1 UTSW 18 15063206 intron probably benign
R1779:Kctd1 UTSW 18 15061782 missense probably benign 0.01
R2083:Kctd1 UTSW 18 14974055 missense possibly damaging 0.89
R2389:Kctd1 UTSW 18 15062211 missense possibly damaging 0.73
R3010:Kctd1 UTSW 18 14974086 missense probably damaging 1.00
R4576:Kctd1 UTSW 18 15007700 missense probably damaging 1.00
R4673:Kctd1 UTSW 18 15063227 intron probably benign
R4884:Kctd1 UTSW 18 14974254 missense probably damaging 1.00
R4961:Kctd1 UTSW 18 15062523 missense probably damaging 0.97
R5169:Kctd1 UTSW 18 15062765 missense possibly damaging 0.72
R5398:Kctd1 UTSW 18 15062265 missense possibly damaging 0.86
R5695:Kctd1 UTSW 18 15063516 intron probably benign
R6175:Kctd1 UTSW 18 14969631 nonsense probably null
R6767:Kctd1 UTSW 18 15062175 missense possibly damaging 0.53
R6852:Kctd1 UTSW 18 14986344 missense possibly damaging 0.72
R6889:Kctd1 UTSW 18 14973988 missense probably damaging 1.00
R7189:Kctd1 UTSW 18 15062643 missense possibly damaging 0.71
R7228:Kctd1 UTSW 18 15062412 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GTCCCAGCTGCACACAAATG -3'
(R):5'- AAACTGGACCGTTACAGAATCTTC -3'

Sequencing Primer
(F):5'- AGCTGCACACAAATGTCCCTTTTC -3'
(R):5'- ACCATGGCCCTATACATGCTGG -3'
Posted On2017-02-15