Incidental Mutation 'R5893:Ablim1'
ID457345
Institutional Source Beutler Lab
Gene Symbol Ablim1
Ensembl Gene ENSMUSG00000025085
Gene Nameactin-binding LIM protein 1
Synonyms2210411C18Rik, abLIM-L, abLIM-M, 4833406P10Rik, abLIM-S, 9330196J19Rik, 2610209L21Rik, Limab1
MMRRC Submission
Accession Numbers

Genbank: NM_178688; MGI: 1194500

Is this an essential gene? Possibly non essential (E-score: 0.430) question?
Stock #R5893 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location57032733-57314919 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 57215853 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 35 (R35S)
Ref Sequence ENSEMBL: ENSMUSP00000107180 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079360] [ENSMUST00000111524] [ENSMUST00000111555] [ENSMUST00000111558] [ENSMUST00000111559]
Predicted Effect probably benign
Transcript: ENSMUST00000079360
AA Change: R35S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000078336
Gene: ENSMUSG00000025085
AA Change: R35S

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
LIM 98 149 1.14e-9 SMART
LIM 157 209 1.37e-12 SMART
LIM 225 276 1.12e-17 SMART
LIM 284 336 5.87e-12 SMART
Pfam:AbLIM_anchor 393 825 1.9e-139 PFAM
VHP 826 861 1.22e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111524
SMART Domains Protein: ENSMUSP00000107149
Gene: ENSMUSG00000025085

DomainStartEndE-ValueType
LIM 21 72 1.14e-9 SMART
LIM 80 132 1.37e-12 SMART
LIM 148 199 1.12e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111555
AA Change: R35S

PolyPhen 2 Score 0.072 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000107180
Gene: ENSMUSG00000025085
AA Change: R35S

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
LIM 98 149 1.14e-9 SMART
LIM 157 209 1.37e-12 SMART
LIM 225 276 1.12e-17 SMART
LIM 284 336 5.87e-12 SMART
low complexity region 360 369 N/A INTRINSIC
coiled coil region 590 614 N/A INTRINSIC
low complexity region 639 654 N/A INTRINSIC
VHP 742 777 1.22e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111558
SMART Domains Protein: ENSMUSP00000107183
Gene: ENSMUSG00000025085

DomainStartEndE-ValueType
LIM 35 86 1.14e-9 SMART
LIM 94 146 1.37e-12 SMART
LIM 162 213 1.12e-17 SMART
LIM 221 273 5.87e-12 SMART
low complexity region 325 334 N/A INTRINSIC
low complexity region 498 503 N/A INTRINSIC
coiled coil region 557 581 N/A INTRINSIC
low complexity region 606 621 N/A INTRINSIC
VHP 709 744 1.22e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111559
SMART Domains Protein: ENSMUSP00000107184
Gene: ENSMUSG00000025085

DomainStartEndE-ValueType
LIM 35 86 1.14e-9 SMART
LIM 94 146 1.37e-12 SMART
LIM 162 213 1.12e-17 SMART
LIM 221 273 5.87e-12 SMART
low complexity region 297 306 N/A INTRINSIC
coiled coil region 527 551 N/A INTRINSIC
low complexity region 576 591 N/A INTRINSIC
VHP 679 714 1.22e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156316
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency 95% (73/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoskeletal LIM protein that binds to actin filaments via a domain that is homologous to erythrocyte dematin. LIM domains, found in over 60 proteins, play key roles in the regulation of developmental pathways. LIM domains also function as protein-binding interfaces, mediating specific protein-protein interactions. The protein encoded by this gene could mediate such interactions between actin filaments and cytoplasmic targets. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutant mice lacking the retina-specific isoform are healthy, fertile, and show no defects in retinal development or retinofugal projections. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted, knock-out(1) Targeted, other(1) Gene trapped(4)

Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb A T 5: 114,229,851 I1637F probably benign Het
Adamts18 A T 8: 113,773,077 C402S probably damaging Het
Adra2b T A 2: 127,364,482 D306E probably benign Het
Ammecr1l C T 18: 31,778,920 T263I probably damaging Het
Antxr1 T C 6: 87,137,259 I509V probably benign Het
Bahcc1 A G 11: 120,285,430 E1967G probably damaging Het
Brap T A 5: 121,679,342 Y337* probably null Het
Brca2 T C 5: 150,569,138 V3206A probably benign Het
C330027C09Rik A G 16: 48,997,500 S78G probably benign Het
Cacna1e A T 1: 154,437,323 F1486I probably damaging Het
Cbx4 A G 11: 119,082,190 Y120H probably damaging Het
Ccar2 T A 14: 70,151,351 Q137L probably benign Het
Ceacam12 A G 7: 18,069,374 D235G probably damaging Het
Celsr1 A G 15: 85,904,014 V2679A probably benign Het
Champ1 C T 8: 13,878,777 P312S probably benign Het
Chst5 A G 8: 111,890,196 L264S probably damaging Het
Colec10 T A 15: 54,410,789 F4L probably benign Het
Cyp2a4 G A 7: 26,308,928 G165D probably damaging Het
Cyp2c29 G C 19: 39,330,389 A438P possibly damaging Het
Dlat A G 9: 50,644,139 probably benign Het
Dmxl2 A G 9: 54,387,420 V2457A possibly damaging Het
Dnah7a A G 1: 53,457,785 M3104T possibly damaging Het
Dock8 C T 19: 25,122,447 H645Y probably damaging Het
Ehbp1l1 T C 19: 5,718,431 E948G probably benign Het
Eps8l2 C T 7: 141,357,624 R384C probably damaging Het
Fam174a A T 1: 95,325,159 N162I probably damaging Het
Fbp2 T A 13: 62,837,102 N335I probably benign Het
Foxred2 C A 15: 77,947,144 G490C probably damaging Het
Fyttd1 T G 16: 32,898,913 D200E probably damaging Het
Gdf15 A T 8: 70,629,823 V211E possibly damaging Het
Gm13084 T A 4: 143,810,468 Y431F probably damaging Het
Gm13178 C T 4: 144,703,196 V408I probably benign Het
Gm5065 A T 7: 5,359,624 T85S probably benign Het
Gm6214 A G 3: 140,839,346 noncoding transcript Het
Havcr2 A G 11: 46,456,316 Y40C probably damaging Het
Htra1 T G 7: 130,961,591 V184G probably damaging Het
Hydin A T 8: 110,490,676 I1399F probably benign Het
Igtp T C 11: 58,206,648 L215P probably damaging Het
Kctd1 T C 18: 14,969,688 E812G possibly damaging Het
Lap3 T C 5: 45,511,279 probably benign Het
Lrp1b C A 2: 40,601,587 A223S probably damaging Het
Mtnr1b A T 9: 15,863,244 V173E probably damaging Het
Nat10 A C 2: 103,721,839 probably benign Het
Ndfip2 T A 14: 105,294,857 V229E probably damaging Het
Nefh G A 11: 4,941,323 T432M probably damaging Het
Nfe2l3 A G 6: 51,457,852 Y464C probably damaging Het
Nrip1 C A 16: 76,293,953 A239S probably damaging Het
Olfml2b A G 1: 170,662,473 S221G probably benign Het
Orc4 G T 2: 48,905,547 S389* probably null Het
P4hb A G 11: 120,571,650 S77P probably damaging Het
Pcyt2 T C 11: 120,617,797 probably null Het
Plagl1 T C 10: 13,128,194 probably benign Het
Poglut1 C T 16: 38,529,595 R272Q probably damaging Het
Rdh5 T C 10: 128,914,221 probably null Het
Rogdi A T 16: 5,013,394 L3* probably null Het
Skap1 T C 11: 96,581,398 *166Q probably null Het
Slc38a4 A G 15: 96,999,551 I461T probably benign Het
Snx31 A C 15: 36,523,455 I360M probably damaging Het
Spata22 A T 11: 73,336,247 K96* probably null Het
Strn3 A T 12: 51,643,223 probably null Het
Trip12 A C 1: 84,759,163 probably benign Het
Uggt1 A T 1: 36,227,628 probably null Het
Upk3a A C 15: 85,019,337 D79A probably damaging Het
Uts2r A T 11: 121,161,279 Y323F probably benign Het
Vmn2r1 A T 3: 64,086,553 N107Y probably damaging Het
Vps13c A T 9: 67,902,839 probably null Het
Wnt7b A G 15: 85,581,374 probably benign Het
Zfp410 T A 12: 84,337,611 probably null Het
Other mutations in Ablim1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Ablim1 APN 19 57068186 missense probably damaging 1.00
IGL00466:Ablim1 APN 19 57068186 missense probably damaging 1.00
IGL00478:Ablim1 APN 19 57068186 missense probably damaging 1.00
IGL00847:Ablim1 APN 19 57152290 missense possibly damaging 0.59
IGL01063:Ablim1 APN 19 57061328 missense probably damaging 1.00
IGL01304:Ablim1 APN 19 57215721 missense probably benign
IGL01385:Ablim1 APN 19 57068914 missense probably damaging 1.00
IGL01707:Ablim1 APN 19 57039447 missense probably damaging 1.00
IGL02386:Ablim1 APN 19 57134654 missense probably damaging 1.00
IGL02427:Ablim1 APN 19 57079880 splice site probably benign
IGL02498:Ablim1 APN 19 57152319 nonsense probably null
A9681:Ablim1 UTSW 19 57173323 critical splice donor site probably null
R0089:Ablim1 UTSW 19 57043031 missense probably damaging 1.00
R0226:Ablim1 UTSW 19 57043870 missense probably damaging 1.00
R1419:Ablim1 UTSW 19 57134633 missense probably damaging 1.00
R1473:Ablim1 UTSW 19 57068236 missense probably damaging 1.00
R1587:Ablim1 UTSW 19 57083547 start codon destroyed probably null 0.99
R1588:Ablim1 UTSW 19 57083547 start codon destroyed probably null 0.99
R1935:Ablim1 UTSW 19 57215965 start gained probably null
R1936:Ablim1 UTSW 19 57215965 start gained probably null
R2021:Ablim1 UTSW 19 57047018 missense probably damaging 0.98
R2110:Ablim1 UTSW 19 57043813 missense possibly damaging 0.83
R2270:Ablim1 UTSW 19 57077431 missense possibly damaging 0.58
R2509:Ablim1 UTSW 19 57152359 missense probably damaging 1.00
R3621:Ablim1 UTSW 19 57152303 missense probably damaging 0.97
R3732:Ablim1 UTSW 19 57049460 critical splice donor site probably null
R3732:Ablim1 UTSW 19 57049460 critical splice donor site probably null
R3733:Ablim1 UTSW 19 57049460 critical splice donor site probably null
R3734:Ablim1 UTSW 19 57049460 critical splice donor site probably null
R3878:Ablim1 UTSW 19 57037210 utr 3 prime probably null
R4354:Ablim1 UTSW 19 57155278 missense probably damaging 1.00
R4543:Ablim1 UTSW 19 57077442 missense possibly damaging 0.87
R4749:Ablim1 UTSW 19 57215721 missense probably benign
R4860:Ablim1 UTSW 19 57079866 missense probably damaging 1.00
R4860:Ablim1 UTSW 19 57079866 missense probably damaging 1.00
R5072:Ablim1 UTSW 19 57073853 critical splice donor site probably null
R5277:Ablim1 UTSW 19 57155261 missense probably damaging 1.00
R5331:Ablim1 UTSW 19 57155249 missense probably damaging 1.00
R5354:Ablim1 UTSW 19 57130923 missense probably benign 0.07
R5958:Ablim1 UTSW 19 57041935 missense probably damaging 1.00
R6435:Ablim1 UTSW 19 57061355 missense possibly damaging 0.69
R6460:Ablim1 UTSW 19 57079839 missense possibly damaging 0.96
R6642:Ablim1 UTSW 19 57130852 missense probably benign 0.03
R6662:Ablim1 UTSW 19 57073853 critical splice donor site probably null
R6705:Ablim1 UTSW 19 57215821 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGCACGACACTGAGGAATGG -3'
(R):5'- ATGCTAGGGGAACTGCTACTG -3'

Sequencing Primer
(F):5'- CGGGGGAGATACTTTAATACCTATG -3'
(R):5'- AACTGCTACTGGGGAGCC -3'
Posted On2017-02-15