Incidental Mutation 'R5894:Atp6v1b2'
ID457380
Institutional Source Beutler Lab
Gene Symbol Atp6v1b2
Ensembl Gene ENSMUSG00000006273
Gene NameATPase, H+ transporting, lysosomal V1 subunit B2
SynonymsAtp6b2, HO57
MMRRC Submission 043238-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5894 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location69088646-69113711 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to A at 69107566 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000006435 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006435]
Predicted Effect probably null
Transcript: ENSMUST00000006435
SMART Domains Protein: ENSMUSP00000006435
Gene: ENSMUSG00000006273

DomainStartEndE-ValueType
Pfam:ATP-synt_ab_N 50 116 3.2e-14 PFAM
Pfam:ATP-synt_ab 173 399 1.9e-69 PFAM
Pfam:ATP-synt_ab_C 416 510 5.1e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123290
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129797
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153079
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of vacuolar ATPase (V-ATPase), a multisubunit enzyme that mediates acidification of eukaryotic intracellular organelles. V-ATPase dependent organelle acidification is necessary for such intracellular processes as protein sorting, zymogen activation, receptor-mediated endocytosis, and synaptic vesicle proton gradient generation. V-ATPase is composed of a cytosolic V1 domain and a transmembrane V0 domain. The V1 domain consists of three A, three B, and two G subunits, as well as a C, D, E, F, and H subunit. The V1 domain contains the ATP catalytic site. The protein encoded by this gene is one of two V1 domain B subunit isoforms and is the only B isoform highly expressed in osteoclasts. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503B20Rik T A 3: 146,650,925 E76V probably benign Het
Adcy2 A T 13: 68,625,852 I1024N probably damaging Het
Agr2 A C 12: 35,995,510 probably benign Het
Alpk2 T A 18: 65,281,072 H1991L probably damaging Het
Amotl2 T A 9: 102,725,172 M448K possibly damaging Het
Ankhd1 T A 18: 36,647,524 F1876L probably damaging Het
Arl14 T C 3: 69,222,676 V52A probably benign Het
Arntl2 A G 6: 146,823,234 T409A possibly damaging Het
Bpifb4 G A 2: 153,940,932 R19H possibly damaging Het
Ccdc144b C T 3: 36,019,975 E342K possibly damaging Het
Cdh9 T A 15: 16,832,100 L358I possibly damaging Het
Ces2h T G 8: 105,019,026 I460M probably benign Het
Cog2 T C 8: 124,545,267 Y507H probably benign Het
Crlf3 T A 11: 80,057,852 R256W probably damaging Het
Csdc2 T A 15: 81,948,680 F96I probably damaging Het
Csk A C 9: 57,628,675 I264S probably damaging Het
Cyp2c29 G C 19: 39,330,389 A438P possibly damaging Het
Ddx43 G A 9: 78,416,734 G449D probably damaging Het
Fbxw18 G T 9: 109,700,167 A106E possibly damaging Het
Fchsd2 C T 7: 101,191,752 T156I probably benign Het
Frs2 T A 10: 117,081,106 probably benign Het
Grid2ip A T 5: 143,388,911 T922S probably damaging Het
Grm1 A G 10: 11,080,255 L95P probably damaging Het
Ift140 T C 17: 25,033,919 V348A possibly damaging Het
Insr A G 8: 3,174,869 S200P possibly damaging Het
Ints12 A T 3: 133,098,558 D102V probably damaging Het
Kank1 A G 19: 25,424,200 D1057G probably damaging Het
Kng1 T A 16: 23,073,363 D225E probably benign Het
Lama1 A T 17: 67,779,047 probably null Het
Lpin2 A G 17: 71,246,934 D882G probably benign Het
Lrp1b A T 2: 41,498,221 F464Y probably benign Het
Musk G A 4: 58,373,583 C836Y probably damaging Het
Mx1 C T 16: 97,454,206 D216N probably damaging Het
Ndrg3 A T 2: 156,928,778 N350K probably benign Het
Oas3 G A 5: 120,756,954 P990L probably damaging Het
Olfr1216 T A 2: 89,014,055 N3I probably damaging Het
Olfr1255 T C 2: 89,817,213 S296P possibly damaging Het
Olfr791 A G 10: 129,526,488 D87G probably damaging Het
Otoa T C 7: 121,121,869 L369P probably damaging Het
Plcg2 A G 8: 117,504,349 T57A probably damaging Het
Prune2 A T 19: 17,121,391 T1420S possibly damaging Het
Ptpdc1 A G 13: 48,590,322 F201S probably damaging Het
Rnf214 A G 9: 45,866,618 V630A probably damaging Het
Rxrb T A 17: 34,035,744 I181N probably damaging Het
Scrib T C 15: 76,067,732 N69S probably damaging Het
Scyl2 A G 10: 89,640,819 S815P probably benign Het
Sgcd A G 11: 47,355,201 V58A probably damaging Het
Slc13a3 C T 2: 165,424,623 V374I probably benign Het
Slc22a4 A T 11: 53,997,515 I229N probably benign Het
Slc44a5 A G 3: 154,256,573 Y381C probably damaging Het
Sohlh1 A G 2: 25,844,667 S205P possibly damaging Het
Spata20 T C 11: 94,483,618 M308V probably damaging Het
Stag3 T G 5: 138,298,838 I550R probably damaging Het
Tac2 A G 10: 127,726,102 E25G possibly damaging Het
Tars2 T C 3: 95,747,652 probably null Het
Tefm G A 11: 80,140,231 R60C probably damaging Het
Trem3 T C 17: 48,258,455 V179A probably benign Het
Trim37 G T 11: 87,201,440 D692Y probably damaging Het
Trpc4ap T C 2: 155,666,213 T173A probably benign Het
Unc13c C T 9: 73,693,204 probably null Het
Usp18 A G 6: 121,261,497 K201R probably benign Het
Usp35 T A 7: 97,313,077 Y524F probably damaging Het
Usp53 A G 3: 122,959,085 F208L probably damaging Het
Vmn1r80 A T 7: 12,193,727 I255F probably damaging Het
Vstm2a A T 11: 16,261,483 I98F probably benign Het
Wdfy4 T A 14: 33,133,360 I766F possibly damaging Het
Wdr17 T A 8: 54,696,300 Y55F probably damaging Het
Xpot T C 10: 121,613,646 K172R probably damaging Het
Other mutations in Atp6v1b2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Atp6v1b2 APN 8 69088934 splice site probably null
IGL00908:Atp6v1b2 APN 8 69096266 missense probably benign 0.00
IGL01914:Atp6v1b2 APN 8 69096280 splice site probably benign
IGL03010:Atp6v1b2 APN 8 69105882 missense probably damaging 0.97
IGL03376:Atp6v1b2 APN 8 69102159 splice site probably benign
R0127:Atp6v1b2 UTSW 8 69103460 missense probably damaging 1.00
R0427:Atp6v1b2 UTSW 8 69101432 missense probably damaging 1.00
R0523:Atp6v1b2 UTSW 8 69109985 missense possibly damaging 0.52
R1754:Atp6v1b2 UTSW 8 69101961 missense probably benign 0.25
R1932:Atp6v1b2 UTSW 8 69102807 nonsense probably null
R1954:Atp6v1b2 UTSW 8 69105903 missense possibly damaging 0.95
R2228:Atp6v1b2 UTSW 8 69102759 splice site probably null
R2229:Atp6v1b2 UTSW 8 69102759 splice site probably null
R4448:Atp6v1b2 UTSW 8 69102022 missense probably benign
R4738:Atp6v1b2 UTSW 8 69103410 missense probably benign
R5243:Atp6v1b2 UTSW 8 69103739 missense probably benign 0.07
R5388:Atp6v1b2 UTSW 8 69101437 missense probably benign 0.00
R5664:Atp6v1b2 UTSW 8 69107620 missense probably damaging 0.99
R5774:Atp6v1b2 UTSW 8 69101961 missense probably damaging 0.97
R6015:Atp6v1b2 UTSW 8 69102496 missense probably damaging 1.00
R6147:Atp6v1b2 UTSW 8 69102482 nonsense probably null
R6217:Atp6v1b2 UTSW 8 69109878 critical splice acceptor site probably null
R6636:Atp6v1b2 UTSW 8 69101374 missense probably damaging 1.00
R6637:Atp6v1b2 UTSW 8 69101374 missense probably damaging 1.00
R7032:Atp6v1b2 UTSW 8 69088896 missense probably benign 0.44
R7108:Atp6v1b2 UTSW 8 69102501 missense probably damaging 1.00
R7184:Atp6v1b2 UTSW 8 69102567 missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- CCTACAGATATGCTTGCAGACC -3'
(R):5'- AGACAACTGATGCCATTTAAAGGC -3'

Sequencing Primer
(F):5'- GATATGCTTGCAGACCAAACC -3'
(R):5'- CTGCTTACTAGGAGAAAACAGTTCC -3'
Posted On2017-02-15