Incidental Mutation 'R5894:Cdh9'
ID457411
Institutional Source Beutler Lab
Gene Symbol Cdh9
Ensembl Gene ENSMUSG00000025370
Gene Namecadherin 9
SynonymsT1-cadherin
MMRRC Submission 043238-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.249) question?
Stock #R5894 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location16728756-16857094 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 16832100 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Isoleucine at position 358 (L358I)
Ref Sequence ENSEMBL: ENSMUSP00000154022 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026432] [ENSMUST00000228307]
Predicted Effect possibly damaging
Transcript: ENSMUST00000026432
AA Change: L358I

PolyPhen 2 Score 0.469 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000026432
Gene: ENSMUSG00000025370
AA Change: L358I

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
CA 75 156 2.84e-15 SMART
CA 180 265 5.63e-28 SMART
CA 289 381 1.12e-13 SMART
CA 404 485 8.03e-24 SMART
CA 508 595 1.34e-2 SMART
transmembrane domain 613 635 N/A INTRINSIC
Pfam:Cadherin_C 638 782 1.5e-54 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227900
Predicted Effect possibly damaging
Transcript: ENSMUST00000228307
AA Change: L358I

PolyPhen 2 Score 0.469 (Sensitivity: 0.89; Specificity: 0.90)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type II classical cadherin from the cadherin superfamily, integral membrane proteins that mediate calcium-dependent cell-cell adhesion. Mature cadherin proteins are composed of a large N-terminal extracellular domain, a single membrane-spanning domain, and a small, highly conserved C-terminal cytoplasmic domain. The extracellular domain consists of 5 subdomains, each containing a cadherin motif, and appears to determine the specificity of the protein's homophilic cell adhesion activity. Type II (atypical) cadherins are defined based on their lack of a HAV cell adhesion recognition sequence specific to type I cadherins. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous knockout results in the formation of abnormal axonal arbors in some retinal type 5 bipolar cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503B20Rik T A 3: 146,650,925 E76V probably benign Het
Adcy2 A T 13: 68,625,852 I1024N probably damaging Het
Agr2 A C 12: 35,995,510 probably benign Het
Alpk2 T A 18: 65,281,072 H1991L probably damaging Het
Amotl2 T A 9: 102,725,172 M448K possibly damaging Het
Ankhd1 T A 18: 36,647,524 F1876L probably damaging Het
Arl14 T C 3: 69,222,676 V52A probably benign Het
Arntl2 A G 6: 146,823,234 T409A possibly damaging Het
Atp6v1b2 T A 8: 69,107,566 probably null Het
Bpifb4 G A 2: 153,940,932 R19H possibly damaging Het
Ccdc144b C T 3: 36,019,975 E342K possibly damaging Het
Ces2h T G 8: 105,019,026 I460M probably benign Het
Cog2 T C 8: 124,545,267 Y507H probably benign Het
Crlf3 T A 11: 80,057,852 R256W probably damaging Het
Csdc2 T A 15: 81,948,680 F96I probably damaging Het
Csk A C 9: 57,628,675 I264S probably damaging Het
Cyp2c29 G C 19: 39,330,389 A438P possibly damaging Het
Ddx43 G A 9: 78,416,734 G449D probably damaging Het
Fbxw18 G T 9: 109,700,167 A106E possibly damaging Het
Fchsd2 C T 7: 101,191,752 T156I probably benign Het
Frs2 T A 10: 117,081,106 probably benign Het
Grid2ip A T 5: 143,388,911 T922S probably damaging Het
Grm1 A G 10: 11,080,255 L95P probably damaging Het
Ift140 T C 17: 25,033,919 V348A possibly damaging Het
Insr A G 8: 3,174,869 S200P possibly damaging Het
Ints12 A T 3: 133,098,558 D102V probably damaging Het
Kank1 A G 19: 25,424,200 D1057G probably damaging Het
Kng1 T A 16: 23,073,363 D225E probably benign Het
Lama1 A T 17: 67,779,047 probably null Het
Lpin2 A G 17: 71,246,934 D882G probably benign Het
Lrp1b A T 2: 41,498,221 F464Y probably benign Het
Musk G A 4: 58,373,583 C836Y probably damaging Het
Mx1 C T 16: 97,454,206 D216N probably damaging Het
Ndrg3 A T 2: 156,928,778 N350K probably benign Het
Oas3 G A 5: 120,756,954 P990L probably damaging Het
Olfr1216 T A 2: 89,014,055 N3I probably damaging Het
Olfr1255 T C 2: 89,817,213 S296P possibly damaging Het
Olfr791 A G 10: 129,526,488 D87G probably damaging Het
Otoa T C 7: 121,121,869 L369P probably damaging Het
Plcg2 A G 8: 117,504,349 T57A probably damaging Het
Prune2 A T 19: 17,121,391 T1420S possibly damaging Het
Ptpdc1 A G 13: 48,590,322 F201S probably damaging Het
Rnf214 A G 9: 45,866,618 V630A probably damaging Het
Rxrb T A 17: 34,035,744 I181N probably damaging Het
Scrib T C 15: 76,067,732 N69S probably damaging Het
Scyl2 A G 10: 89,640,819 S815P probably benign Het
Sgcd A G 11: 47,355,201 V58A probably damaging Het
Slc13a3 C T 2: 165,424,623 V374I probably benign Het
Slc22a4 A T 11: 53,997,515 I229N probably benign Het
Slc44a5 A G 3: 154,256,573 Y381C probably damaging Het
Sohlh1 A G 2: 25,844,667 S205P possibly damaging Het
Spata20 T C 11: 94,483,618 M308V probably damaging Het
Stag3 T G 5: 138,298,838 I550R probably damaging Het
Tac2 A G 10: 127,726,102 E25G possibly damaging Het
Tars2 T C 3: 95,747,652 probably null Het
Tefm G A 11: 80,140,231 R60C probably damaging Het
Trem3 T C 17: 48,258,455 V179A probably benign Het
Trim37 G T 11: 87,201,440 D692Y probably damaging Het
Trpc4ap T C 2: 155,666,213 T173A probably benign Het
Unc13c C T 9: 73,693,204 probably null Het
Usp18 A G 6: 121,261,497 K201R probably benign Het
Usp35 T A 7: 97,313,077 Y524F probably damaging Het
Usp53 A G 3: 122,959,085 F208L probably damaging Het
Vmn1r80 A T 7: 12,193,727 I255F probably damaging Het
Vstm2a A T 11: 16,261,483 I98F probably benign Het
Wdfy4 T A 14: 33,133,360 I766F possibly damaging Het
Wdr17 T A 8: 54,696,300 Y55F probably damaging Het
Xpot T C 10: 121,613,646 K172R probably damaging Het
Other mutations in Cdh9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Cdh9 APN 15 16828362 missense probably damaging 1.00
IGL00555:Cdh9 APN 15 16823406 missense probably damaging 1.00
IGL01110:Cdh9 APN 15 16855926 missense possibly damaging 0.63
IGL01432:Cdh9 APN 15 16830947 missense probably damaging 1.00
IGL01768:Cdh9 APN 15 16778225 missense possibly damaging 0.51
IGL02043:Cdh9 APN 15 16856232 missense probably damaging 1.00
IGL02304:Cdh9 APN 15 16848601 missense probably benign 0.01
IGL02380:Cdh9 APN 15 16856000 missense possibly damaging 0.79
IGL02505:Cdh9 APN 15 16855989 missense probably damaging 1.00
IGL02675:Cdh9 APN 15 16849076 splice site probably null
IGL02679:Cdh9 APN 15 16832230 missense probably damaging 0.97
IGL03288:Cdh9 APN 15 16856049 missense probably damaging 1.00
R0426:Cdh9 UTSW 15 16823454 critical splice donor site probably null
R0726:Cdh9 UTSW 15 16831044 missense probably benign 0.00
R1335:Cdh9 UTSW 15 16850792 missense probably benign 0.00
R1368:Cdh9 UTSW 15 16848482 splice site probably benign
R1766:Cdh9 UTSW 15 16778306 missense probably damaging 1.00
R1916:Cdh9 UTSW 15 16823275 missense probably benign 0.03
R2325:Cdh9 UTSW 15 16778200 missense probably benign
R2424:Cdh9 UTSW 15 16850354 missense probably damaging 1.00
R3104:Cdh9 UTSW 15 16855814 missense probably damaging 1.00
R3837:Cdh9 UTSW 15 16823438 nonsense probably null
R3839:Cdh9 UTSW 15 16823438 nonsense probably null
R4241:Cdh9 UTSW 15 16849079 critical splice acceptor site probably null
R4248:Cdh9 UTSW 15 16850388 missense probably benign 0.00
R4576:Cdh9 UTSW 15 16832239 missense possibly damaging 0.73
R4679:Cdh9 UTSW 15 16850959 missense probably benign
R4896:Cdh9 UTSW 15 16778156 missense probably benign 0.12
R4961:Cdh9 UTSW 15 16850828 missense probably benign
R5050:Cdh9 UTSW 15 16778147 missense probably benign 0.12
R5089:Cdh9 UTSW 15 16778276 missense probably damaging 1.00
R5268:Cdh9 UTSW 15 16851013 missense probably benign
R5567:Cdh9 UTSW 15 16855844 missense probably damaging 1.00
R5646:Cdh9 UTSW 15 16823285 missense probably damaging 1.00
R6440:Cdh9 UTSW 15 16823423 missense probably benign 0.01
R6441:Cdh9 UTSW 15 16823423 missense probably benign 0.01
R7225:Cdh9 UTSW 15 16856073 missense probably damaging 1.00
R7247:Cdh9 UTSW 15 16778255 missense probably damaging 1.00
X0062:Cdh9 UTSW 15 16848539 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- GCATAGTTACTTAGCGCTACTTG -3'
(R):5'- GGATGTATTTATTGCTGTGACTCAC -3'

Sequencing Primer
(F):5'- CAACGATTGCTATCTTCAGAT -3'
(R):5'- ACACAAATAGATAGATGCTTTTCAGG -3'
Posted On2017-02-15