Incidental Mutation 'R5895:A430105I19Rik'
ID457434
Institutional Source Beutler Lab
Gene Symbol A430105I19Rik
Ensembl Gene ENSMUSG00000045838
Gene NameRIKEN cDNA A430105I19 gene
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5895 (G1)
Quality Score154
Status Validated
Chromosome2
Chromosomal Location118754158-118762661 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 118759617 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 249 (T249A)
Ref Sequence ENSEMBL: ENSMUSP00000051853 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059997]
Predicted Effect probably benign
Transcript: ENSMUST00000059997
AA Change: T249A

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000051853
Gene: ENSMUSG00000045838
AA Change: T249A

DomainStartEndE-ValueType
coiled coil region 52 100 N/A INTRINSIC
low complexity region 142 154 N/A INTRINSIC
Pfam:DUF4594 185 361 1.2e-64 PFAM
low complexity region 515 529 N/A INTRINSIC
low complexity region 535 544 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151270
Meta Mutation Damage Score 0.1192 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.3%
  • 20x: 91.7%
Validation Efficiency 98% (64/65)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a G A 5: 8,702,216 G426S probably damaging Het
Casp4 A T 9: 5,328,573 probably benign Het
Ccdc40 T A 11: 119,253,403 F988Y probably damaging Het
Chd5 T A 4: 152,379,932 V1516E probably benign Het
Chrnd T A 1: 87,195,667 probably null Het
Col5a3 C A 9: 20,772,442 G1506V unknown Het
Csgalnact2 A T 6: 118,129,254 C34* probably null Het
Ddx23 T C 15: 98,651,951 K195E probably benign Het
Dhps T G 8: 85,074,251 S240A probably benign Het
Dnah5 T A 15: 28,234,453 probably null Het
Dock10 T C 1: 80,536,959 T1414A probably benign Het
Dock4 A G 12: 40,755,813 D928G probably damaging Het
Dolpp1 T C 2: 30,395,646 probably benign Het
Dse T A 10: 34,152,605 I830F probably damaging Het
Elmod1 C T 9: 53,935,807 R29Q probably damaging Het
Ephx4 T A 5: 107,429,652 probably null Het
Evi5 A T 5: 107,820,436 M215K probably damaging Het
Fbxl4 T C 4: 22,390,678 L287P probably damaging Het
Gbp9 G A 5: 105,082,858 S400L probably damaging Het
Gm6291 T C 18: 6,371,365 noncoding transcript Het
Gmcl1 A T 6: 86,711,614 D301E probably benign Het
Gna14 C T 19: 16,603,328 R177C possibly damaging Het
Golph3 C T 15: 12,339,670 R90C probably damaging Het
Gpr142 T A 11: 114,798,959 C12* probably null Het
Hat1 T A 2: 71,409,013 N43K possibly damaging Het
Hivep1 A T 13: 42,157,218 E978V possibly damaging Het
Hormad1 G A 3: 95,559,733 probably null Het
Kalrn C T 16: 33,975,435 probably benign Het
Mars T C 10: 127,296,549 T860A probably benign Het
Mdn1 A T 4: 32,695,400 L1146F probably damaging Het
Met A G 6: 17,531,582 T620A probably benign Het
Mppe1 T C 18: 67,225,763 E378G probably benign Het
Mybpc3 T A 2: 91,124,665 V481D probably damaging Het
Myh14 A T 7: 44,606,709 L1924Q probably damaging Het
Mylip G T 13: 45,408,702 E327* probably null Het
Naip1 C T 13: 100,423,128 G1123R probably benign Het
Naip6 A G 13: 100,315,992 V187A possibly damaging Het
Ncam1 T A 9: 49,507,043 T986S probably benign Het
Olfr1274-ps T C 2: 90,401,456 I265T probably benign Het
Olfr1342 T C 4: 118,690,117 I112V probably damaging Het
Phactr2 C T 10: 13,245,517 G480S probably damaging Het
Por A G 5: 135,715,984 I34V probably benign Het
Ppp2r5b C T 19: 6,234,734 R33H probably damaging Het
Prkdc C A 16: 15,752,829 Y2325* probably null Het
Prx A G 7: 27,515,284 E73G probably damaging Het
Rbms2 C A 10: 128,145,687 A126S possibly damaging Het
Rhoq C T 17: 86,994,689 A111V probably damaging Het
Rpl14 T A 9: 120,574,174 probably benign Het
Serbp1 A G 6: 67,272,886 *75W probably null Het
Sptbn1 C A 11: 30,123,978 V1351F probably damaging Het
Supt16 A G 14: 52,164,522 V897A probably benign Het
Tfdp1 T A 8: 13,357,038 probably null Het
Ttn T A 2: 76,950,143 Y1088F probably damaging Het
Vmn2r105 G T 17: 20,228,667 Q83K probably benign Het
Wdr76 A T 2: 121,528,842 S221C probably damaging Het
Zfhx2 G T 14: 55,065,891 F1545L probably benign Het
Zfp318 A G 17: 46,399,033 I561V probably damaging Het
Other mutations in A430105I19Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00469:A430105I19Rik APN 2 118759689 missense possibly damaging 0.94
IGL03327:A430105I19Rik APN 2 118761670 missense probably damaging 1.00
R1269:A430105I19Rik UTSW 2 118761390 missense possibly damaging 0.65
R1453:A430105I19Rik UTSW 2 118757422 missense possibly damaging 0.91
R1495:A430105I19Rik UTSW 2 118760532 missense probably damaging 1.00
R1529:A430105I19Rik UTSW 2 118761760 critical splice acceptor site probably null
R1765:A430105I19Rik UTSW 2 118760647 missense probably benign 0.02
R4766:A430105I19Rik UTSW 2 118759577 missense probably damaging 1.00
R5445:A430105I19Rik UTSW 2 118759586 missense probably damaging 1.00
R5891:A430105I19Rik UTSW 2 118761383 missense probably damaging 1.00
R7271:A430105I19Rik UTSW 2 118760683 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- AGAGGCACCCATAGTTAGCC -3'
(R):5'- TGCAAAAGGTCCACAGCAAG -3'

Sequencing Primer
(F):5'- TAGTTAGCCCTACCCAAGTCC -3'
(R):5'- CGAGACAGACCTAATTATGTACTGG -3'
Posted On2017-02-15