Incidental Mutation 'R5895:Rbms2'
ID457460
Institutional Source Beutler Lab
Gene Symbol Rbms2
Ensembl Gene ENSMUSG00000040043
Gene NameRNA binding motif, single stranded interacting protein 2
SynonymsScr3, 2610315E04Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.187) question?
Stock #R5895 (G1)
Quality Score219
Status Validated
Chromosome10
Chromosomal Location128131558-128180297 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 128145687 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 126 (A126S)
Ref Sequence ENSEMBL: ENSMUSP00000089664 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092033] [ENSMUST00000099139]
Predicted Effect possibly damaging
Transcript: ENSMUST00000092033
AA Change: A126S

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000089664
Gene: ENSMUSG00000040043
AA Change: A126S

DomainStartEndE-ValueType
low complexity region 41 51 N/A INTRINSIC
RRM 59 127 3.35e-16 SMART
RRM 138 209 1.94e-12 SMART
low complexity region 347 359 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099139
AA Change: A98S

PolyPhen 2 Score 0.165 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000096742
Gene: ENSMUSG00000040043
AA Change: A98S

DomainStartEndE-ValueType
low complexity region 13 23 N/A INTRINSIC
RRM 31 99 3.35e-16 SMART
RRM 110 181 1.94e-12 SMART
low complexity region 319 331 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218884
Meta Mutation Damage Score 0.288 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.3%
  • 20x: 91.7%
Validation Efficiency 98% (64/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of a small family of proteins which bind single stranded DNA/RNA. These proteins are characterized by the presence of two sets of ribonucleoprotein consensus sequence (RNP-CS) that contain conserved motifs, RNP1 and RNP2, originally described in RNA binding proteins, and required for DNA binding. The RBMS proteins have been implicated in such diverse functions as DNA replication, gene transcription, cell cycle progression and apoptosis. This protein was isolated by phenotypic complementation of cdc2 and cdc13 mutants of yeast and is thought to suppress cdc2 and cdc13 mutants through the induction of translation of cdc2. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430105I19Rik T C 2: 118,759,617 T249A probably benign Het
Abcb1a G A 5: 8,702,216 G426S probably damaging Het
Casp4 A T 9: 5,328,573 probably benign Het
Ccdc40 T A 11: 119,253,403 F988Y probably damaging Het
Chd5 T A 4: 152,379,932 V1516E probably benign Het
Chrnd T A 1: 87,195,667 probably null Het
Col5a3 C A 9: 20,772,442 G1506V unknown Het
Csgalnact2 A T 6: 118,129,254 C34* probably null Het
Ddx23 T C 15: 98,651,951 K195E probably benign Het
Dhps T G 8: 85,074,251 S240A probably benign Het
Dnah5 T A 15: 28,234,453 probably null Het
Dock10 T C 1: 80,536,959 T1414A probably benign Het
Dock4 A G 12: 40,755,813 D928G probably damaging Het
Dolpp1 T C 2: 30,395,646 probably benign Het
Dse T A 10: 34,152,605 I830F probably damaging Het
Elmod1 C T 9: 53,935,807 R29Q probably damaging Het
Ephx4 T A 5: 107,429,652 probably null Het
Evi5 A T 5: 107,820,436 M215K probably damaging Het
Fbxl4 T C 4: 22,390,678 L287P probably damaging Het
Gbp9 G A 5: 105,082,858 S400L probably damaging Het
Gm6291 T C 18: 6,371,365 noncoding transcript Het
Gmcl1 A T 6: 86,711,614 D301E probably benign Het
Gna14 C T 19: 16,603,328 R177C possibly damaging Het
Golph3 C T 15: 12,339,670 R90C probably damaging Het
Gpr142 T A 11: 114,798,959 C12* probably null Het
Hat1 T A 2: 71,409,013 N43K possibly damaging Het
Hivep1 A T 13: 42,157,218 E978V possibly damaging Het
Hormad1 G A 3: 95,559,733 probably null Het
Kalrn C T 16: 33,975,435 probably benign Het
Mars T C 10: 127,296,549 T860A probably benign Het
Mdn1 A T 4: 32,695,400 L1146F probably damaging Het
Met A G 6: 17,531,582 T620A probably benign Het
Mppe1 T C 18: 67,225,763 E378G probably benign Het
Mybpc3 T A 2: 91,124,665 V481D probably damaging Het
Myh14 A T 7: 44,606,709 L1924Q probably damaging Het
Mylip G T 13: 45,408,702 E327* probably null Het
Naip1 C T 13: 100,423,128 G1123R probably benign Het
Naip6 A G 13: 100,315,992 V187A possibly damaging Het
Ncam1 T A 9: 49,507,043 T986S probably benign Het
Olfr1274-ps T C 2: 90,401,456 I265T probably benign Het
Olfr1342 T C 4: 118,690,117 I112V probably damaging Het
Phactr2 C T 10: 13,245,517 G480S probably damaging Het
Por A G 5: 135,715,984 I34V probably benign Het
Ppp2r5b C T 19: 6,234,734 R33H probably damaging Het
Prkdc C A 16: 15,752,829 Y2325* probably null Het
Prx A G 7: 27,515,284 E73G probably damaging Het
Rhoq C T 17: 86,994,689 A111V probably damaging Het
Rpl14 T A 9: 120,574,174 probably benign Het
Serbp1 A G 6: 67,272,886 *75W probably null Het
Sptbn1 C A 11: 30,123,978 V1351F probably damaging Het
Supt16 A G 14: 52,164,522 V897A probably benign Het
Tfdp1 T A 8: 13,357,038 probably null Het
Ttn T A 2: 76,950,143 Y1088F probably damaging Het
Vmn2r105 G T 17: 20,228,667 Q83K probably benign Het
Wdr76 A T 2: 121,528,842 S221C probably damaging Het
Zfhx2 G T 14: 55,065,891 F1545L probably benign Het
Zfp318 A G 17: 46,399,033 I561V probably damaging Het
Other mutations in Rbms2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02573:Rbms2 APN 10 128143440 missense probably damaging 1.00
IGL03331:Rbms2 APN 10 128133635 unclassified probably benign
R0143:Rbms2 UTSW 10 128137954 missense probably benign 0.17
R0458:Rbms2 UTSW 10 128151189 missense probably damaging 1.00
R0494:Rbms2 UTSW 10 128133670 missense probably benign 0.00
R1348:Rbms2 UTSW 10 128176345 splice site probably null
R1809:Rbms2 UTSW 10 128138186 missense possibly damaging 0.91
R2059:Rbms2 UTSW 10 128137518 missense probably benign 0.00
R3709:Rbms2 UTSW 10 128143443 missense probably damaging 1.00
R3710:Rbms2 UTSW 10 128143443 missense probably damaging 1.00
R4001:Rbms2 UTSW 10 128151300 missense probably benign 0.03
R5316:Rbms2 UTSW 10 128145737 missense probably damaging 0.98
R5494:Rbms2 UTSW 10 128137691 missense probably damaging 0.98
R6306:Rbms2 UTSW 10 128151181 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CTGCTGTGCACATGAACACAC -3'
(R):5'- ATGGACAACTCTCAGTCTCCC -3'

Sequencing Primer
(F):5'- TGTGCACATGAACACACACACATATG -3'
(R):5'- ACTCCATCATTTACATAGTCCATACC -3'
Posted On2017-02-15