Incidental Mutation 'R5896:Olfr984'
ID457523
Institutional Source Beutler Lab
Gene Symbol Olfr984
Ensembl Gene ENSMUSG00000045812
Gene Nameolfactory receptor 984
SynonymsMOR239-6, GA_x6K02T2PVTD-33799484-33798540
MMRRC Submission 044095-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.181) question?
Stock #R5896 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location40096515-40114206 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 40100893 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 199 (M199K)
Ref Sequence ENSEMBL: ENSMUSP00000150287 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056795] [ENSMUST00000213858] [ENSMUST00000214856] [ENSMUST00000217536]
Predicted Effect probably damaging
Transcript: ENSMUST00000056795
AA Change: M199K

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000060787
Gene: ENSMUSG00000045812
AA Change: M199K

DomainStartEndE-ValueType
Pfam:7tm_4 31 305 1.3e-42 PFAM
Pfam:7tm_1 41 287 6e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213858
AA Change: M199K

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000214856
AA Change: M199K

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000217536
AA Change: M199K

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.3%
  • 20x: 91.5%
Validation Efficiency 99% (86/87)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061N02Rik A T 16: 88,707,433 S159T probably damaging Het
2610028H24Rik T A 10: 76,452,830 M53K probably benign Het
3425401B19Rik G A 14: 32,661,675 Q778* probably null Het
Abhd16a T A 17: 35,091,725 probably benign Het
Acp6 A G 3: 97,168,494 K226R probably benign Het
Ankfy1 A G 11: 72,759,985 D998G probably damaging Het
Apbb1 G T 7: 105,574,225 P60T probably damaging Het
Apol9a T A 15: 77,404,505 I221F probably benign Het
Arhgap29 A G 3: 122,012,087 E947G possibly damaging Het
B430218F22Rik A T 13: 118,387,398 probably benign Het
BC003331 A T 1: 150,380,360 N211K probably benign Het
Carmil3 ACCCCC ACCCCCCC 14: 55,503,999 probably null Het
Ccdc69 C T 11: 55,052,890 probably null Het
Ccdc93 G T 1: 121,463,120 V274L possibly damaging Het
Cdc25a A G 9: 109,884,365 D191G probably benign Het
Cmya5 A G 13: 93,045,865 probably null Het
Crebzf TGGAGGAGGAGGAGGAGGA TGGAGGAGGAGGAGGA 7: 90,443,271 probably benign Het
Csde1 T C 3: 103,040,543 probably benign Het
Ctdp1 A G 18: 80,458,788 L177P probably damaging Het
Dnah5 T A 15: 28,272,060 H1003Q probably benign Het
Epb41l2 T A 10: 25,493,596 N604K probably damaging Het
Fam166a A T 2: 25,220,566 M129L probably benign Het
Fig4 T A 10: 41,254,885 N465Y possibly damaging Het
Gemin7 G A 7: 19,565,298 S124F probably damaging Het
Gli3 G A 13: 15,726,180 R1384K probably benign Het
Gm11127 T A 17: 36,056,344 M329L probably benign Het
Gm12258 G A 11: 58,859,631 C544Y probably damaging Het
Grm1 C T 10: 11,080,550 probably benign Het
Hps4 C T 5: 112,369,485 T246I probably benign Het
Ifngr2 A T 16: 91,561,765 E284D possibly damaging Het
Impdh2 A G 9: 108,563,966 T148A probably benign Het
Irx3 T C 8: 91,801,135 S36G probably benign Het
Itga5 T A 15: 103,351,087 K667N probably benign Het
Itgad G A 7: 128,174,016 C15Y probably benign Het
Ly75 T G 2: 60,383,146 E29A probably benign Het
Magi1 T A 6: 93,708,199 S506C probably damaging Het
Map4 G A 9: 110,072,634 V781M possibly damaging Het
Med23 T C 10: 24,902,145 L797P probably damaging Het
Naip1 C T 13: 100,423,128 G1123R probably benign Het
Ncor1 G T 11: 62,383,190 P55Q probably damaging Het
Ofcc1 T A 13: 40,180,584 I344F probably benign Het
Olfr1161 A G 2: 88,025,121 Y133C probably damaging Het
Olfr1247 C A 2: 89,609,323 V260F probably damaging Het
Olfr173 G A 16: 58,797,732 T38I probably damaging Het
Otub2 C T 12: 103,403,428 probably benign Het
Parva A G 7: 112,544,753 M83V probably benign Het
Pcdha8 T A 18: 36,993,519 N351K probably benign Het
Pcdhb5 T A 18: 37,322,679 L704* probably null Het
Pkd1l3 T A 8: 109,626,836 L683H probably damaging Het
Plekhn1 C T 4: 156,223,874 R288H probably benign Het
Polr2a A T 11: 69,736,260 N1457K probably damaging Het
Ppp1r12b A G 1: 134,765,981 S981P probably damaging Het
Ppp1r9a A G 6: 5,159,648 K1062E probably damaging Het
Ptpre A T 7: 135,674,278 T498S probably benign Het
Pus7l C T 15: 94,529,451 probably null Het
Rptn C T 3: 93,398,332 Q991* probably null Het
Rsu1 T G 2: 13,224,359 E76A probably damaging Het
Sept11 T A 5: 93,156,965 F214I probably damaging Het
Slc1a7 G T 4: 108,012,390 A551S probably benign Het
Slc45a2 T A 15: 11,000,855 Y13* probably null Het
Slc7a14 T G 3: 31,257,570 L100F probably damaging Het
Slit3 A G 11: 35,708,105 E1512G probably damaging Het
Stat5a A G 11: 100,877,057 Q458R possibly damaging Het
Svep1 T C 4: 58,084,906 T1811A possibly damaging Het
Tarbp1 A G 8: 126,452,928 F624L probably benign Het
Tfeb T G 17: 47,759,508 probably null Het
Tnxb G A 17: 34,672,152 G490R probably damaging Het
Tra2b T C 16: 22,259,203 Y32C probably damaging Het
Trpv4 C T 5: 114,622,647 probably benign Het
Uvrag A T 7: 98,988,207 L138* probably null Het
Vwf A T 6: 125,678,762 probably null Het
Wdr47 G A 3: 108,619,006 D282N probably damaging Het
Xirp2 A G 2: 67,508,698 M428V probably benign Het
Xirp2 A G 2: 67,509,946 N844D possibly damaging Het
Znfx1 G A 2: 167,039,000 T288I probably damaging Het
Other mutations in Olfr984
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00946:Olfr984 APN 9 40101154 missense probably benign 0.03
IGL01402:Olfr984 APN 9 40101262 missense probably benign 0.00
IGL01404:Olfr984 APN 9 40101262 missense probably benign 0.00
IGL01445:Olfr984 APN 9 40101312 missense probably benign 0.45
IGL01448:Olfr984 APN 9 40101082 missense probably damaging 0.97
IGL02598:Olfr984 APN 9 40100565 missense probably benign
IGL03106:Olfr984 APN 9 40100734 missense probably damaging 1.00
R0616:Olfr984 UTSW 9 40100987 missense probably damaging 1.00
R0712:Olfr984 UTSW 9 40101430 missense probably benign
R2049:Olfr984 UTSW 9 40101119 missense probably benign
R2938:Olfr984 UTSW 9 40100743 missense probably benign 0.20
R4609:Olfr984 UTSW 9 40100806 missense possibly damaging 0.81
R4907:Olfr984 UTSW 9 40100659 missense probably benign 0.02
R5001:Olfr984 UTSW 9 40101227 missense probably benign 0.02
R5174:Olfr984 UTSW 9 40100747 missense possibly damaging 0.87
R5587:Olfr984 UTSW 9 40101244 missense probably damaging 1.00
R5880:Olfr984 UTSW 9 40101247 missense possibly damaging 0.95
R6611:Olfr984 UTSW 9 40101020 missense probably benign 0.03
R6904:Olfr984 UTSW 9 40101356 missense probably benign 0.04
R7015:Olfr984 UTSW 9 40101455 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- GCACAGAAACTGCCTTGTC -3'
(R):5'- TGTGGGATCTTCATGGCAGC -3'

Sequencing Primer
(F):5'- AGAAACTGCCTTGTCCATGG -3'
(R):5'- GATCTTCATGGCAGCCTCGTG -3'
Posted On2017-02-15