Incidental Mutation 'R5896:Slit3'
ID457534
Institutional Source Beutler Lab
Gene Symbol Slit3
Ensembl Gene ENSMUSG00000056427
Gene Nameslit guidance ligand 3
SynonymsSlit1
MMRRC Submission 044095-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.819) question?
Stock #R5896 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location35121224-35708507 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 35708105 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1512 (E1512G)
Ref Sequence ENSEMBL: ENSMUSP00000066857 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069837]
Predicted Effect probably damaging
Transcript: ENSMUST00000069837
AA Change: E1512G

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000066857
Gene: ENSMUSG00000056427
AA Change: E1512G

DomainStartEndE-ValueType
low complexity region 2 23 N/A INTRINSIC
LRRNT 33 65 2.12e-8 SMART
LRR 59 83 1.37e2 SMART
LRR_TYP 84 107 1.12e-3 SMART
LRR_TYP 108 131 7.78e-3 SMART
LRR_TYP 132 155 5.42e-2 SMART
LRR 156 179 5.88e0 SMART
LRR 180 203 7.55e-1 SMART
LRRCT 215 264 1.33e-6 SMART
LRRNT 279 311 6.79e-7 SMART
LRR 305 329 1.16e2 SMART
LRR 330 353 1.26e1 SMART
LRR_TYP 354 377 2.79e-4 SMART
LRR 378 401 4.05e-1 SMART
LRR 402 425 4.05e-1 SMART
LRRCT 437 486 7.75e-8 SMART
LRRNT 504 536 1.95e-7 SMART
LRR_TYP 556 579 7.49e-5 SMART
LRR 581 603 6.41e1 SMART
LRR_TYP 604 627 2.53e-2 SMART
LRR 628 651 1.76e-1 SMART
LRRCT 663 712 2.52e-7 SMART
LRRNT 724 756 3e-8 SMART
LRR 774 797 2.14e0 SMART
LRR_TYP 798 821 2.95e-3 SMART
LRR_TYP 822 845 2.43e-4 SMART
LRRCT 857 906 1.12e-13 SMART
EGF 919 953 6.86e-4 SMART
EGF 958 994 8.84e-7 SMART
EGF 999 1032 1.13e-4 SMART
EGF 1037 1072 2.3e-5 SMART
EGF_CA 1074 1110 5.92e-8 SMART
EGF 1122 1155 3.79e-6 SMART
LamG 1178 1314 3.16e-34 SMART
EGF 1331 1365 2.19e-2 SMART
EGF 1371 1403 1.13e-4 SMART
EGF 1411 1444 5.57e-4 SMART
CT 1455 1523 4.56e-5 SMART
Meta Mutation Damage Score 0.164 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.3%
  • 20x: 91.5%
Validation Efficiency 99% (86/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is secreted, likely interacting with roundabout homolog receptors to effect cell migration. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2012]
PHENOTYPE: Mice homozygous for a gene trap allele show congenital diaphragmatic hernia (CDH), variable renal defects and enlarged heart right ventricles. Mice homozygous for either of two reporter alleles show diaphragm dysgenesis and die prematurely; those with end-stage CDH show dyspnea and lung congestion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061N02Rik A T 16: 88,707,433 S159T probably damaging Het
2610028H24Rik T A 10: 76,452,830 M53K probably benign Het
3425401B19Rik G A 14: 32,661,675 Q778* probably null Het
Abhd16a T A 17: 35,091,725 probably benign Het
Acp6 A G 3: 97,168,494 K226R probably benign Het
Ankfy1 A G 11: 72,759,985 D998G probably damaging Het
Apbb1 G T 7: 105,574,225 P60T probably damaging Het
Apol9a T A 15: 77,404,505 I221F probably benign Het
Arhgap29 A G 3: 122,012,087 E947G possibly damaging Het
B430218F22Rik A T 13: 118,387,398 probably benign Het
BC003331 A T 1: 150,380,360 N211K probably benign Het
Carmil3 ACCCCC ACCCCCCC 14: 55,503,999 probably null Het
Ccdc69 C T 11: 55,052,890 probably null Het
Ccdc93 G T 1: 121,463,120 V274L possibly damaging Het
Cdc25a A G 9: 109,884,365 D191G probably benign Het
Cmya5 A G 13: 93,045,865 probably null Het
Crebzf TGGAGGAGGAGGAGGAGGA TGGAGGAGGAGGAGGA 7: 90,443,271 probably benign Het
Csde1 T C 3: 103,040,543 probably benign Het
Ctdp1 A G 18: 80,458,788 L177P probably damaging Het
Dnah5 T A 15: 28,272,060 H1003Q probably benign Het
Epb41l2 T A 10: 25,493,596 N604K probably damaging Het
Fam166a A T 2: 25,220,566 M129L probably benign Het
Fig4 T A 10: 41,254,885 N465Y possibly damaging Het
Gemin7 G A 7: 19,565,298 S124F probably damaging Het
Gli3 G A 13: 15,726,180 R1384K probably benign Het
Gm11127 T A 17: 36,056,344 M329L probably benign Het
Gm12258 G A 11: 58,859,631 C544Y probably damaging Het
Grm1 C T 10: 11,080,550 probably benign Het
Hps4 C T 5: 112,369,485 T246I probably benign Het
Ifngr2 A T 16: 91,561,765 E284D possibly damaging Het
Impdh2 A G 9: 108,563,966 T148A probably benign Het
Irx3 T C 8: 91,801,135 S36G probably benign Het
Itga5 T A 15: 103,351,087 K667N probably benign Het
Itgad G A 7: 128,174,016 C15Y probably benign Het
Ly75 T G 2: 60,383,146 E29A probably benign Het
Magi1 T A 6: 93,708,199 S506C probably damaging Het
Map4 G A 9: 110,072,634 V781M possibly damaging Het
Med23 T C 10: 24,902,145 L797P probably damaging Het
Naip1 C T 13: 100,423,128 G1123R probably benign Het
Ncor1 G T 11: 62,383,190 P55Q probably damaging Het
Ofcc1 T A 13: 40,180,584 I344F probably benign Het
Olfr1161 A G 2: 88,025,121 Y133C probably damaging Het
Olfr1247 C A 2: 89,609,323 V260F probably damaging Het
Olfr173 G A 16: 58,797,732 T38I probably damaging Het
Olfr984 A T 9: 40,100,893 M199K probably damaging Het
Otub2 C T 12: 103,403,428 probably benign Het
Parva A G 7: 112,544,753 M83V probably benign Het
Pcdha8 T A 18: 36,993,519 N351K probably benign Het
Pcdhb5 T A 18: 37,322,679 L704* probably null Het
Pkd1l3 T A 8: 109,626,836 L683H probably damaging Het
Plekhn1 C T 4: 156,223,874 R288H probably benign Het
Polr2a A T 11: 69,736,260 N1457K probably damaging Het
Ppp1r12b A G 1: 134,765,981 S981P probably damaging Het
Ppp1r9a A G 6: 5,159,648 K1062E probably damaging Het
Ptpre A T 7: 135,674,278 T498S probably benign Het
Pus7l C T 15: 94,529,451 probably null Het
Rptn C T 3: 93,398,332 Q991* probably null Het
Rsu1 T G 2: 13,224,359 E76A probably damaging Het
Sept11 T A 5: 93,156,965 F214I probably damaging Het
Slc1a7 G T 4: 108,012,390 A551S probably benign Het
Slc45a2 T A 15: 11,000,855 Y13* probably null Het
Slc7a14 T G 3: 31,257,570 L100F probably damaging Het
Stat5a A G 11: 100,877,057 Q458R possibly damaging Het
Svep1 T C 4: 58,084,906 T1811A possibly damaging Het
Tarbp1 A G 8: 126,452,928 F624L probably benign Het
Tfeb T G 17: 47,759,508 probably null Het
Tnxb G A 17: 34,672,152 G490R probably damaging Het
Tra2b T C 16: 22,259,203 Y32C probably damaging Het
Trpv4 C T 5: 114,622,647 probably benign Het
Uvrag A T 7: 98,988,207 L138* probably null Het
Vwf A T 6: 125,678,762 probably null Het
Wdr47 G A 3: 108,619,006 D282N probably damaging Het
Xirp2 A G 2: 67,508,698 M428V probably benign Het
Xirp2 A G 2: 67,509,946 N844D possibly damaging Het
Znfx1 G A 2: 167,039,000 T288I probably damaging Het
Other mutations in Slit3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00731:Slit3 APN 11 35622154 missense probably damaging 1.00
IGL01324:Slit3 APN 11 35610702 missense probably damaging 1.00
IGL01612:Slit3 APN 11 35700384 missense possibly damaging 0.95
IGL02145:Slit3 APN 11 35629742 missense probably damaging 0.99
IGL02146:Slit3 APN 11 35234848 missense possibly damaging 0.71
IGL02430:Slit3 APN 11 35177774 splice site probably null
IGL02528:Slit3 APN 11 35578974 missense probably benign
IGL02530:Slit3 APN 11 35708142 makesense probably null
IGL02640:Slit3 APN 11 35700345 missense probably benign 0.10
IGL02819:Slit3 APN 11 35171590 missense possibly damaging 0.71
IGL02839:Slit3 APN 11 35649047 missense possibly damaging 0.46
IGL03150:Slit3 APN 11 35508257 missense possibly damaging 0.88
IGL03161:Slit3 APN 11 35700414 missense probably benign 0.10
IGL03336:Slit3 APN 11 35670101 missense probably damaging 0.97
bloated UTSW 11 35633952 missense possibly damaging 0.55
quellung UTSW 11 35651820 critical splice donor site probably null
IGL02988:Slit3 UTSW 11 35708063 missense probably damaging 0.99
PIT4791001:Slit3 UTSW 11 35661245 missense possibly damaging 0.85
R0013:Slit3 UTSW 11 35707918 missense probably benign
R0013:Slit3 UTSW 11 35707918 missense probably benign
R0334:Slit3 UTSW 11 35579101 missense probably damaging 0.97
R0385:Slit3 UTSW 11 35700282 missense probably damaging 0.98
R0840:Slit3 UTSW 11 35623436 splice site probably benign
R1065:Slit3 UTSW 11 35121635 missense possibly damaging 0.86
R1364:Slit3 UTSW 11 35670107 missense probably benign
R1476:Slit3 UTSW 11 35686299 missense probably damaging 0.97
R1508:Slit3 UTSW 11 35570621 missense probably damaging 1.00
R1665:Slit3 UTSW 11 35234906 missense possibly damaging 0.71
R1692:Slit3 UTSW 11 35659344 missense probably damaging 1.00
R1696:Slit3 UTSW 11 35675923 missense probably damaging 0.99
R1727:Slit3 UTSW 11 35629832 missense probably damaging 1.00
R1752:Slit3 UTSW 11 35564653 missense probably damaging 0.98
R1970:Slit3 UTSW 11 35630841 critical splice acceptor site probably null
R2077:Slit3 UTSW 11 35544748 missense possibly damaging 0.88
R2126:Slit3 UTSW 11 35688679 missense probably damaging 1.00
R2143:Slit3 UTSW 11 35612261 splice site probably null
R2162:Slit3 UTSW 11 35688682 missense probably null 1.00
R2873:Slit3 UTSW 11 35544793 nonsense probably null
R3813:Slit3 UTSW 11 35675979 missense probably damaging 1.00
R3831:Slit3 UTSW 11 35688682 missense probably null 1.00
R3832:Slit3 UTSW 11 35688682 missense probably null 1.00
R3833:Slit3 UTSW 11 35688682 missense probably null 1.00
R3839:Slit3 UTSW 11 35508237 missense probably benign 0.10
R4152:Slit3 UTSW 11 35698320 missense probably damaging 0.98
R4387:Slit3 UTSW 11 35684048 missense probably benign 0.12
R4795:Slit3 UTSW 11 35651820 critical splice donor site probably null
R4910:Slit3 UTSW 11 35632722 missense probably damaging 0.99
R4933:Slit3 UTSW 11 35688593 missense probably damaging 1.00
R5048:Slit3 UTSW 11 35588985 missense probably damaging 1.00
R5106:Slit3 UTSW 11 35612367 missense probably damaging 1.00
R5138:Slit3 UTSW 11 35588985 missense probably damaging 1.00
R5218:Slit3 UTSW 11 35684175 critical splice donor site probably null
R5338:Slit3 UTSW 11 35622148 missense probably benign
R5354:Slit3 UTSW 11 35675913 missense probably damaging 1.00
R5436:Slit3 UTSW 11 35707911 missense probably benign 0.05
R5933:Slit3 UTSW 11 35629751 missense probably benign 0.04
R5963:Slit3 UTSW 11 35700236 missense probably damaging 1.00
R5964:Slit3 UTSW 11 35700236 missense probably damaging 1.00
R6125:Slit3 UTSW 11 35570733 critical splice donor site probably null
R6153:Slit3 UTSW 11 35700483 missense possibly damaging 0.69
R6484:Slit3 UTSW 11 35661298 missense probably benign
R6526:Slit3 UTSW 11 35661292 missense probably benign 0.33
R6797:Slit3 UTSW 11 35633952 missense possibly damaging 0.55
R6887:Slit3 UTSW 11 35544806 splice site probably null
R7067:Slit3 UTSW 11 35508230 missense probably benign 0.04
R7150:Slit3 UTSW 11 35570719 missense probably damaging 1.00
X0028:Slit3 UTSW 11 35564637 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GATAGTCCGTGAAGCCATCC -3'
(R):5'- GTCCATATACTCAGACGGTGTG -3'

Sequencing Primer
(F):5'- CGCCGCCAGAAAGACTACG -3'
(R):5'- CAAAGAGGTTCCATGTGG -3'
Posted On2017-02-15