Incidental Mutation 'R5896:Gm12258'
ID457536
Institutional Source Beutler Lab
Gene Symbol Gm12258
Ensembl Gene ENSMUSG00000072915
Gene Namepredicted gene 12258
Synonyms
MMRRC Submission 044095-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.754) question?
Stock #R5896 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location58847158-58861956 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 58859631 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 544 (C544Y)
Ref Sequence ENSEMBL: ENSMUSP00000117644 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093768] [ENSMUST00000139337]
Predicted Effect probably damaging
Transcript: ENSMUST00000093768
AA Change: C66Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000091282
Gene: ENSMUSG00000072915
AA Change: C66Y

DomainStartEndE-ValueType
ZnF_C2H2 8 30 5.21e-4 SMART
ZnF_C2H2 36 58 1.03e-2 SMART
ZnF_C2H2 64 86 2.4e-3 SMART
ZnF_C2H2 92 114 4.17e-3 SMART
ZnF_C2H2 120 142 8.34e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000139337
AA Change: C544Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117644
Gene: ENSMUSG00000072915
AA Change: C544Y

DomainStartEndE-ValueType
KRAB 56 116 1.8e-32 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.3%
  • 20x: 91.5%
Validation Efficiency 99% (86/87)
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061N02Rik A T 16: 88,707,433 S159T probably damaging Het
2610028H24Rik T A 10: 76,452,830 M53K probably benign Het
3425401B19Rik G A 14: 32,661,675 Q778* probably null Het
Abhd16a T A 17: 35,091,725 probably benign Het
Acp6 A G 3: 97,168,494 K226R probably benign Het
Ankfy1 A G 11: 72,759,985 D998G probably damaging Het
Apbb1 G T 7: 105,574,225 P60T probably damaging Het
Apol9a T A 15: 77,404,505 I221F probably benign Het
Arhgap29 A G 3: 122,012,087 E947G possibly damaging Het
B430218F22Rik A T 13: 118,387,398 probably benign Het
BC003331 A T 1: 150,380,360 N211K probably benign Het
Carmil3 ACCCCC ACCCCCCC 14: 55,503,999 probably null Het
Ccdc69 C T 11: 55,052,890 probably null Het
Ccdc93 G T 1: 121,463,120 V274L possibly damaging Het
Cdc25a A G 9: 109,884,365 D191G probably benign Het
Cmya5 A G 13: 93,045,865 probably null Het
Crebzf TGGAGGAGGAGGAGGAGGA TGGAGGAGGAGGAGGA 7: 90,443,271 probably benign Het
Csde1 T C 3: 103,040,543 probably benign Het
Ctdp1 A G 18: 80,458,788 L177P probably damaging Het
Dnah5 T A 15: 28,272,060 H1003Q probably benign Het
Epb41l2 T A 10: 25,493,596 N604K probably damaging Het
Fam166a A T 2: 25,220,566 M129L probably benign Het
Fig4 T A 10: 41,254,885 N465Y possibly damaging Het
Gemin7 G A 7: 19,565,298 S124F probably damaging Het
Gli3 G A 13: 15,726,180 R1384K probably benign Het
Gm11127 T A 17: 36,056,344 M329L probably benign Het
Grm1 C T 10: 11,080,550 probably benign Het
Hps4 C T 5: 112,369,485 T246I probably benign Het
Ifngr2 A T 16: 91,561,765 E284D possibly damaging Het
Impdh2 A G 9: 108,563,966 T148A probably benign Het
Irx3 T C 8: 91,801,135 S36G probably benign Het
Itga5 T A 15: 103,351,087 K667N probably benign Het
Itgad G A 7: 128,174,016 C15Y probably benign Het
Ly75 T G 2: 60,383,146 E29A probably benign Het
Magi1 T A 6: 93,708,199 S506C probably damaging Het
Map4 G A 9: 110,072,634 V781M possibly damaging Het
Med23 T C 10: 24,902,145 L797P probably damaging Het
Naip1 C T 13: 100,423,128 G1123R probably benign Het
Ncor1 G T 11: 62,383,190 P55Q probably damaging Het
Ofcc1 T A 13: 40,180,584 I344F probably benign Het
Olfr1161 A G 2: 88,025,121 Y133C probably damaging Het
Olfr1247 C A 2: 89,609,323 V260F probably damaging Het
Olfr173 G A 16: 58,797,732 T38I probably damaging Het
Olfr984 A T 9: 40,100,893 M199K probably damaging Het
Otub2 C T 12: 103,403,428 probably benign Het
Parva A G 7: 112,544,753 M83V probably benign Het
Pcdha8 T A 18: 36,993,519 N351K probably benign Het
Pcdhb5 T A 18: 37,322,679 L704* probably null Het
Pkd1l3 T A 8: 109,626,836 L683H probably damaging Het
Plekhn1 C T 4: 156,223,874 R288H probably benign Het
Polr2a A T 11: 69,736,260 N1457K probably damaging Het
Ppp1r12b A G 1: 134,765,981 S981P probably damaging Het
Ppp1r9a A G 6: 5,159,648 K1062E probably damaging Het
Ptpre A T 7: 135,674,278 T498S probably benign Het
Pus7l C T 15: 94,529,451 probably null Het
Rptn C T 3: 93,398,332 Q991* probably null Het
Rsu1 T G 2: 13,224,359 E76A probably damaging Het
Sept11 T A 5: 93,156,965 F214I probably damaging Het
Slc1a7 G T 4: 108,012,390 A551S probably benign Het
Slc45a2 T A 15: 11,000,855 Y13* probably null Het
Slc7a14 T G 3: 31,257,570 L100F probably damaging Het
Slit3 A G 11: 35,708,105 E1512G probably damaging Het
Stat5a A G 11: 100,877,057 Q458R possibly damaging Het
Svep1 T C 4: 58,084,906 T1811A possibly damaging Het
Tarbp1 A G 8: 126,452,928 F624L probably benign Het
Tfeb T G 17: 47,759,508 probably null Het
Tnxb G A 17: 34,672,152 G490R probably damaging Het
Tra2b T C 16: 22,259,203 Y32C probably damaging Het
Trpv4 C T 5: 114,622,647 probably benign Het
Uvrag A T 7: 98,988,207 L138* probably null Het
Vwf A T 6: 125,678,762 probably null Het
Wdr47 G A 3: 108,619,006 D282N probably damaging Het
Xirp2 A G 2: 67,508,698 M428V probably benign Het
Xirp2 A G 2: 67,509,946 N844D possibly damaging Het
Znfx1 G A 2: 167,039,000 T288I probably damaging Het
Other mutations in Gm12258
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00557:Gm12258 APN 11 58856070 missense probably benign
IGL01391:Gm12258 APN 11 58848694 missense probably benign 0.03
IGL03081:Gm12258 APN 11 58858259 missense probably benign 0.07
R1521:Gm12258 UTSW 11 58859555 missense probably damaging 1.00
R1653:Gm12258 UTSW 11 58858287 missense possibly damaging 0.68
R3895:Gm12258 UTSW 11 58858549 nonsense probably null
R4065:Gm12258 UTSW 11 58858526 missense probably benign 0.08
R4066:Gm12258 UTSW 11 58858526 missense probably benign 0.08
R4747:Gm12258 UTSW 11 58859596 missense probably damaging 1.00
R4803:Gm12258 UTSW 11 58859030 missense probably benign 0.06
R5554:Gm12258 UTSW 11 58858468 missense possibly damaging 0.92
R5956:Gm12258 UTSW 11 58859459 missense probably benign 0.02
R6277:Gm12258 UTSW 11 58854287 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCTTTTACAAGCGAGCCC -3'
(R):5'- ATGAACTAGCTTCAAGGCTCATC -3'

Sequencing Primer
(F):5'- GAGAAACCCTTTGCGTGTGATAC -3'
(R):5'- TGCCTAGTGAGGTGGAATTTCAAAC -3'
Posted On2017-02-15