Incidental Mutation 'R5898:Tbrg4'
ID457676
Institutional Source Beutler Lab
Gene Symbol Tbrg4
Ensembl Gene ENSMUSG00000000384
Gene Nametransforming growth factor beta regulated gene 4
Synonyms2310042P22Rik, TB-12, Cpr2
MMRRC Submission 044097-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.889) question?
Stock #R5898 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location6615598-6626067 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 6617372 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 576 (D576G)
Ref Sequence ENSEMBL: ENSMUSP00000140835 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000394] [ENSMUST00000136682] [ENSMUST00000150697] [ENSMUST00000156969] [ENSMUST00000189268]
Predicted Effect probably damaging
Transcript: ENSMUST00000000394
AA Change: D576G

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000000394
Gene: ENSMUSG00000000384
AA Change: D576G

DomainStartEndE-ValueType
low complexity region 41 50 N/A INTRINSIC
Pfam:FAST_1 368 437 5.9e-24 PFAM
Pfam:FAST_2 450 535 7.4e-27 PFAM
RAP 562 619 4.01e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082561
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083752
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131313
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131477
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132446
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134016
Predicted Effect probably benign
Transcript: ENSMUST00000136682
SMART Domains Protein: ENSMUSP00000114174
Gene: ENSMUSG00000000384

DomainStartEndE-ValueType
low complexity region 41 50 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150697
SMART Domains Protein: ENSMUSP00000123131
Gene: ENSMUSG00000000384

DomainStartEndE-ValueType
low complexity region 41 50 N/A INTRINSIC
SCOP:d1gw5a_ 81 250 6e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151008
Predicted Effect probably damaging
Transcript: ENSMUST00000156969
AA Change: D576G

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000114256
Gene: ENSMUSG00000000384
AA Change: D576G

DomainStartEndE-ValueType
low complexity region 41 50 N/A INTRINSIC
Pfam:FAST_1 367 438 1.1e-23 PFAM
Pfam:FAST_2 448 535 7.4e-29 PFAM
RAP 562 619 4.01e-10 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000189268
AA Change: D576G

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000140835
Gene: ENSMUSG00000000384
AA Change: D576G

DomainStartEndE-ValueType
low complexity region 41 50 N/A INTRINSIC
Pfam:FAST_1 367 438 1.1e-23 PFAM
Pfam:FAST_2 448 535 7.4e-29 PFAM
RAP 562 619 4.01e-10 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 93.8%
Validation Efficiency 96% (86/90)
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik G T 10: 100,612,900 R158L possibly damaging Het
1700017N19Rik G A 10: 100,615,208 M179I probably benign Het
5430419D17Rik T G 7: 131,241,967 probably null Het
Abhd12 T C 2: 150,839,778 I231V possibly damaging Het
Adsl A G 15: 80,961,353 probably null Het
Ahnak C A 19: 9,013,767 N4138K possibly damaging Het
Ahnak T C 19: 9,018,211 S5620P probably damaging Het
Akap13 C T 7: 75,729,146 T2145I probably damaging Het
Alpk2 T A 18: 65,307,623 Q700L probably damaging Het
Apobec1 T C 6: 122,580,773 Y159C probably damaging Het
Atg9a T C 1: 75,186,272 T395A probably damaging Het
Atp6v1f A G 6: 29,467,958 I48V probably benign Het
BC051665 A C 13: 60,782,704 V278G probably damaging Het
Bicd1 A T 6: 149,513,703 H638L probably damaging Het
Cacna2d4 A G 6: 119,274,231 Y460C probably damaging Het
Ccdc157 C A 11: 4,144,538 R496L probably benign Het
Cep44 C G 8: 56,541,021 V174L probably damaging Het
Clca1 G T 3: 145,016,761 F283L possibly damaging Het
Csk T C 9: 57,630,302 T110A probably benign Het
Cspg4 T A 9: 56,885,222 probably null Het
Cutc A G 19: 43,760,029 I124V probably benign Het
Cyp2d9 A G 15: 82,455,524 T104A probably benign Het
Cyp2j9 G T 4: 96,577,714 T294K probably benign Het
D630003M21Rik T A 2: 158,204,657 probably null Het
Dcaf15 G T 8: 84,098,452 F450L probably damaging Het
Ddhd1 A T 14: 45,602,668 I723K probably damaging Het
Dnah17 C T 11: 118,114,213 A782T probably benign Het
Dnah3 T C 7: 120,078,501 D399G probably benign Het
Dync2h1 T C 9: 7,148,717 N909S probably benign Het
Erbin A G 13: 103,839,305 probably null Het
Fanci G A 7: 79,433,321 V682I probably benign Het
Fap A T 2: 62,573,503 F9L probably benign Het
Fat3 T C 9: 15,938,461 I3882V probably benign Het
Fkbp15 A T 4: 62,326,057 probably null Het
Fsd2 T C 7: 81,537,227 Y601C probably damaging Het
Gm5900 T C 7: 104,950,261 noncoding transcript Het
Gramd4 G T 15: 86,100,784 G82V probably damaging Het
Hc C T 2: 34,997,437 V1352I probably benign Het
Hsph1 A T 5: 149,625,158 N466K probably damaging Het
Ice2 T A 9: 69,408,262 D133E probably benign Het
Ifi213 T C 1: 173,568,979 M510V probably benign Het
Itpkb T G 1: 180,421,315 L861R probably damaging Het
Kbtbd3 T A 9: 4,330,476 D283E probably damaging Het
Man2a1 A G 17: 64,625,380 K154R probably benign Het
Masp1 T A 16: 23,491,927 I252F probably damaging Het
Megf11 G T 9: 64,685,964 C586F probably damaging Het
Myh2 C A 11: 67,192,719 A1476E possibly damaging Het
Myo18b A T 5: 112,802,330 probably null Het
Naip6 A T 13: 100,299,321 V898E possibly damaging Het
Nav1 T C 1: 135,585,146 M59V probably benign Het
Nlrp3 A T 11: 59,546,852 Y119F probably benign Het
Oxa1l T A 14: 54,363,301 I77N possibly damaging Het
Pcdhb8 T A 18: 37,357,484 D738E possibly damaging Het
Pdia5 A T 16: 35,422,965 W269R probably damaging Het
Peak1 T A 9: 56,207,338 T1440S probably benign Het
Piezo1 A G 8: 122,487,943 V1547A probably benign Het
Pkp1 T C 1: 135,882,521 Y437C probably damaging Het
Pla2r1 T C 2: 60,422,760 D1329G probably damaging Het
Ppip5k2 T C 1: 97,744,162 probably benign Het
Prrg4 C T 2: 104,845,033 S75N probably benign Het
Psmb9 T A 17: 34,182,292 I198F probably damaging Het
Rcbtb2 T A 14: 73,161,965 L23* probably null Het
Sbno1 A T 5: 124,386,791 probably benign Het
Scn3a T C 2: 65,514,695 E483G probably damaging Het
Sdccag8 T A 1: 176,824,822 D46E probably benign Het
Selenov A G 7: 28,288,154 F293L probably damaging Het
Sept2 A C 1: 93,479,301 D20A probably benign Het
Shc1 T A 3: 89,426,967 Y313* probably null Het
Siglec1 T A 2: 131,073,633 Y1346F probably damaging Het
Slc22a5 T A 11: 53,873,733 I296F probably damaging Het
Slc9c1 A G 16: 45,544,760 N152S probably damaging Het
Smoc1 C T 12: 81,104,757 R83* probably null Het
Ssx2ip A G 3: 146,427,831 D227G possibly damaging Het
Tbx20 T A 9: 24,758,859 Y226F probably damaging Het
Trav10d G T 14: 52,811,472 A107S probably damaging Het
Trim60 A T 8: 65,000,364 L411* probably null Het
Ttbk2 A T 2: 120,745,040 V1083D probably benign Het
Unc93a T A 17: 13,125,577 Q26L probably damaging Het
Usp14 T A 18: 10,022,819 N65I possibly damaging Het
Vip A T 10: 5,643,988 S114C probably damaging Het
Vmn1r237 A T 17: 21,314,551 I179F probably damaging Het
Wdr47 T A 3: 108,637,885 probably null Het
Zfp975 A T 7: 42,662,539 C217S probably damaging Het
Other mutations in Tbrg4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01656:Tbrg4 APN 11 6618522 missense possibly damaging 0.94
IGL02225:Tbrg4 APN 11 6624094 missense probably damaging 0.97
IGL02332:Tbrg4 APN 11 6618492 missense probably damaging 0.98
PIT4449001:Tbrg4 UTSW 11 6619689 missense probably damaging 1.00
PIT4453001:Tbrg4 UTSW 11 6620857 missense probably damaging 1.00
R0412:Tbrg4 UTSW 11 6623832 missense probably benign
R0732:Tbrg4 UTSW 11 6620812 missense probably benign 0.19
R0943:Tbrg4 UTSW 11 6619008 missense probably damaging 1.00
R3960:Tbrg4 UTSW 11 6618077 missense probably benign
R4618:Tbrg4 UTSW 11 6620185 intron probably benign
R4686:Tbrg4 UTSW 11 6618468 missense probably benign 0.00
R4767:Tbrg4 UTSW 11 6620909 missense probably benign 0.00
R5240:Tbrg4 UTSW 11 6617516 critical splice donor site probably null
R5457:Tbrg4 UTSW 11 6620947 missense probably damaging 1.00
R7173:Tbrg4 UTSW 11 6620810 missense possibly damaging 0.80
R7343:Tbrg4 UTSW 11 6620065 missense probably benign 0.28
X0013:Tbrg4 UTSW 11 6617540 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- ATGTACCCACAGGAGGCAAG -3'
(R):5'- AGAAACTTCGTTGCTCCCCAC -3'

Sequencing Primer
(F):5'- CCACAGGAGGCAAGCCAAG -3'
(R):5'- ACCTTGCCCAGCCAGTG -3'
Posted On2017-02-15