Incidental Mutation 'R5898:Adsl'
ID457689
Institutional Source Beutler Lab
Gene Symbol Adsl
Ensembl Gene ENSMUSG00000022407
Gene Nameadenylosuccinate lyase
Synonyms
MMRRC Submission 044097-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5898 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location80948490-80970946 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 80961353 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000146546 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023043] [ENSMUST00000023043] [ENSMUST00000164806] [ENSMUST00000164806] [ENSMUST00000166711] [ENSMUST00000168756] [ENSMUST00000168756] [ENSMUST00000169238] [ENSMUST00000200201] [ENSMUST00000207170] [ENSMUST00000207170]
Predicted Effect probably null
Transcript: ENSMUST00000023043
SMART Domains Protein: ENSMUSP00000023043
Gene: ENSMUSG00000022407

DomainStartEndE-ValueType
Pfam:Lyase_1 49 313 4.4e-29 PFAM
ADSL_C 377 461 5.65e-28 SMART
Predicted Effect probably null
Transcript: ENSMUST00000023043
SMART Domains Protein: ENSMUSP00000023043
Gene: ENSMUSG00000022407

DomainStartEndE-ValueType
Pfam:Lyase_1 49 313 4.4e-29 PFAM
ADSL_C 377 461 5.65e-28 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163575
Predicted Effect probably null
Transcript: ENSMUST00000164806
SMART Domains Protein: ENSMUSP00000131998
Gene: ENSMUSG00000022407

DomainStartEndE-ValueType
Pfam:Lyase_1 47 313 8.4e-29 PFAM
Blast:ADSL_C 377 416 2e-6 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000164806
SMART Domains Protein: ENSMUSP00000131998
Gene: ENSMUSG00000022407

DomainStartEndE-ValueType
Pfam:Lyase_1 47 313 8.4e-29 PFAM
Blast:ADSL_C 377 416 2e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000166711
SMART Domains Protein: ENSMUSP00000129601
Gene: ENSMUSG00000022407

DomainStartEndE-ValueType
PDB:2VD6|D 1 134 3e-87 PDB
SCOP:d1c3ca_ 20 134 9e-25 SMART
Predicted Effect probably null
Transcript: ENSMUST00000168756
SMART Domains Protein: ENSMUSP00000127593
Gene: ENSMUSG00000022407

DomainStartEndE-ValueType
Pfam:Lyase_1 115 298 3.9e-25 PFAM
ADSL_C 362 446 5.65e-28 SMART
Predicted Effect probably null
Transcript: ENSMUST00000168756
SMART Domains Protein: ENSMUSP00000127593
Gene: ENSMUSG00000022407

DomainStartEndE-ValueType
Pfam:Lyase_1 115 298 3.9e-25 PFAM
ADSL_C 362 446 5.65e-28 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169238
SMART Domains Protein: ENSMUSP00000132423
Gene: ENSMUSG00000022407

DomainStartEndE-ValueType
PDB:2VD6|D 1 134 3e-87 PDB
SCOP:d1c3ca_ 20 134 9e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000199284
Predicted Effect probably benign
Transcript: ENSMUST00000200201
SMART Domains Protein: ENSMUSP00000143188
Gene: ENSMUSG00000022407

DomainStartEndE-ValueType
PDB:2VD6|D 1 119 6e-77 PDB
SCOP:d1c3ca_ 20 119 4e-21 SMART
Predicted Effect probably null
Transcript: ENSMUST00000207170
Predicted Effect probably null
Transcript: ENSMUST00000207170
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 93.8%
Validation Efficiency 96% (86/90)
MGI Phenotype FUNCTION: This gene encodes a protein that is involved in adenosine monophosphate (AMP) biosynthesis and maintaining AMP levels in the muscle. The encoded enzyme catalyzes the release of fumarate during AMP biosynthesis by cleaving the substrates succinylaminoimidazole carboxamide (SAICA) ribotide to give aminoimidazole carboxamide (AICA) ribotide, and adenylosuccinate to give adenylate. In humans, this gene is associated with adenylosuccinate deficiency, a rare autosomal disorder resulting in a spectrum of neurological symptoms. A pseudogene associated with this gene is located on the X chromosome. [provided by RefSeq, Jan 2013]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik G T 10: 100,612,900 R158L possibly damaging Het
1700017N19Rik G A 10: 100,615,208 M179I probably benign Het
5430419D17Rik T G 7: 131,241,967 probably null Het
Abhd12 T C 2: 150,839,778 I231V possibly damaging Het
Ahnak C A 19: 9,013,767 N4138K possibly damaging Het
Ahnak T C 19: 9,018,211 S5620P probably damaging Het
Akap13 C T 7: 75,729,146 T2145I probably damaging Het
Alpk2 T A 18: 65,307,623 Q700L probably damaging Het
Apobec1 T C 6: 122,580,773 Y159C probably damaging Het
Atg9a T C 1: 75,186,272 T395A probably damaging Het
Atp6v1f A G 6: 29,467,958 I48V probably benign Het
BC051665 A C 13: 60,782,704 V278G probably damaging Het
Bicd1 A T 6: 149,513,703 H638L probably damaging Het
Cacna2d4 A G 6: 119,274,231 Y460C probably damaging Het
Ccdc157 C A 11: 4,144,538 R496L probably benign Het
Cep44 C G 8: 56,541,021 V174L probably damaging Het
Clca1 G T 3: 145,016,761 F283L possibly damaging Het
Csk T C 9: 57,630,302 T110A probably benign Het
Cspg4 T A 9: 56,885,222 probably null Het
Cutc A G 19: 43,760,029 I124V probably benign Het
Cyp2d9 A G 15: 82,455,524 T104A probably benign Het
Cyp2j9 G T 4: 96,577,714 T294K probably benign Het
D630003M21Rik T A 2: 158,204,657 probably null Het
Dcaf15 G T 8: 84,098,452 F450L probably damaging Het
Ddhd1 A T 14: 45,602,668 I723K probably damaging Het
Dnah17 C T 11: 118,114,213 A782T probably benign Het
Dnah3 T C 7: 120,078,501 D399G probably benign Het
Dync2h1 T C 9: 7,148,717 N909S probably benign Het
Erbin A G 13: 103,839,305 probably null Het
Fanci G A 7: 79,433,321 V682I probably benign Het
Fap A T 2: 62,573,503 F9L probably benign Het
Fat3 T C 9: 15,938,461 I3882V probably benign Het
Fkbp15 A T 4: 62,326,057 probably null Het
Fsd2 T C 7: 81,537,227 Y601C probably damaging Het
Gm5900 T C 7: 104,950,261 noncoding transcript Het
Gramd4 G T 15: 86,100,784 G82V probably damaging Het
Hc C T 2: 34,997,437 V1352I probably benign Het
Hsph1 A T 5: 149,625,158 N466K probably damaging Het
Ice2 T A 9: 69,408,262 D133E probably benign Het
Ifi213 T C 1: 173,568,979 M510V probably benign Het
Itpkb T G 1: 180,421,315 L861R probably damaging Het
Kbtbd3 T A 9: 4,330,476 D283E probably damaging Het
Man2a1 A G 17: 64,625,380 K154R probably benign Het
Masp1 T A 16: 23,491,927 I252F probably damaging Het
Megf11 G T 9: 64,685,964 C586F probably damaging Het
Myh2 C A 11: 67,192,719 A1476E possibly damaging Het
Myo18b A T 5: 112,802,330 probably null Het
Naip6 A T 13: 100,299,321 V898E possibly damaging Het
Nav1 T C 1: 135,585,146 M59V probably benign Het
Nlrp3 A T 11: 59,546,852 Y119F probably benign Het
Oxa1l T A 14: 54,363,301 I77N possibly damaging Het
Pcdhb8 T A 18: 37,357,484 D738E possibly damaging Het
Pdia5 A T 16: 35,422,965 W269R probably damaging Het
Peak1 T A 9: 56,207,338 T1440S probably benign Het
Piezo1 A G 8: 122,487,943 V1547A probably benign Het
Pkp1 T C 1: 135,882,521 Y437C probably damaging Het
Pla2r1 T C 2: 60,422,760 D1329G probably damaging Het
Ppip5k2 T C 1: 97,744,162 probably benign Het
Prrg4 C T 2: 104,845,033 S75N probably benign Het
Psmb9 T A 17: 34,182,292 I198F probably damaging Het
Rcbtb2 T A 14: 73,161,965 L23* probably null Het
Sbno1 A T 5: 124,386,791 probably benign Het
Scn3a T C 2: 65,514,695 E483G probably damaging Het
Sdccag8 T A 1: 176,824,822 D46E probably benign Het
Selenov A G 7: 28,288,154 F293L probably damaging Het
Sept2 A C 1: 93,479,301 D20A probably benign Het
Shc1 T A 3: 89,426,967 Y313* probably null Het
Siglec1 T A 2: 131,073,633 Y1346F probably damaging Het
Slc22a5 T A 11: 53,873,733 I296F probably damaging Het
Slc9c1 A G 16: 45,544,760 N152S probably damaging Het
Smoc1 C T 12: 81,104,757 R83* probably null Het
Ssx2ip A G 3: 146,427,831 D227G possibly damaging Het
Tbrg4 T C 11: 6,617,372 D576G probably damaging Het
Tbx20 T A 9: 24,758,859 Y226F probably damaging Het
Trav10d G T 14: 52,811,472 A107S probably damaging Het
Trim60 A T 8: 65,000,364 L411* probably null Het
Ttbk2 A T 2: 120,745,040 V1083D probably benign Het
Unc93a T A 17: 13,125,577 Q26L probably damaging Het
Usp14 T A 18: 10,022,819 N65I possibly damaging Het
Vip A T 10: 5,643,988 S114C probably damaging Het
Vmn1r237 A T 17: 21,314,551 I179F probably damaging Het
Wdr47 T A 3: 108,637,885 probably null Het
Zfp975 A T 7: 42,662,539 C217S probably damaging Het
Other mutations in Adsl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01637:Adsl APN 15 80948700 missense probably null 0.24
IGL02249:Adsl APN 15 80960475 missense probably benign 0.26
IGL03009:Adsl APN 15 80952243 nonsense probably null
R0046:Adsl UTSW 15 80962788 critical splice donor site probably null
R0046:Adsl UTSW 15 80962788 critical splice donor site probably null
R0194:Adsl UTSW 15 80961360 missense possibly damaging 0.91
R0575:Adsl UTSW 15 80963685 missense probably damaging 1.00
R1111:Adsl UTSW 15 80967660 missense probably damaging 1.00
R1606:Adsl UTSW 15 80952224 nonsense probably null
R1822:Adsl UTSW 15 80962742 nonsense probably null
R2152:Adsl UTSW 15 80967662 missense probably damaging 1.00
R2284:Adsl UTSW 15 80963895 missense probably damaging 0.99
R4008:Adsl UTSW 15 80966156 missense probably benign 0.05
R4010:Adsl UTSW 15 80966156 missense probably benign 0.05
R4011:Adsl UTSW 15 80966156 missense probably benign 0.05
R4202:Adsl UTSW 15 80952216 missense probably damaging 0.98
R4587:Adsl UTSW 15 80967767 critical splice donor site probably null
R5053:Adsl UTSW 15 80960450 missense probably damaging 1.00
R5086:Adsl UTSW 15 80963700 missense probably damaging 0.96
R5123:Adsl UTSW 15 80952294 unclassified probably null
R5187:Adsl UTSW 15 80948905 intron probably benign
R5416:Adsl UTSW 15 80952183 splice site probably null
R5532:Adsl UTSW 15 80963909 missense probably damaging 1.00
R7401:Adsl UTSW 15 80962782 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAACACACTTAGACTGAGCACTTAC -3'
(R):5'- GGCATGCACTCAAGTAAAATACTC -3'

Sequencing Primer
(F):5'- TGAACCAGGCTTTTGAACACCTG -3'
(R):5'- TCAAATATGCACACACAAAAAGAAG -3'
Posted On2017-02-15