Incidental Mutation 'R5898:Pcdhb8'
ID457700
Institutional Source Beutler Lab
Gene Symbol Pcdhb8
Ensembl Gene ENSMUSG00000045876
Gene Nameprotocadherin beta 8
SynonymsPcdhb5C, PcdhbH
MMRRC Submission 044097-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R5898 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location37355121-37358604 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 37357484 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 738 (D738E)
Ref Sequence ENSEMBL: ENSMUSP00000054371 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051163] [ENSMUST00000115661] [ENSMUST00000192867] [ENSMUST00000194544]
Predicted Effect possibly damaging
Transcript: ENSMUST00000051163
AA Change: D738E

PolyPhen 2 Score 0.916 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000054371
Gene: ENSMUSG00000045876
AA Change: D738E

DomainStartEndE-ValueType
Pfam:Cadherin_2 30 112 6.6e-33 PFAM
CA 155 240 7.79e-22 SMART
CA 264 344 3.02e-28 SMART
CA 367 448 1.14e-23 SMART
CA 472 558 9.51e-26 SMART
CA 588 669 5.65e-10 SMART
Pfam:Cadherin_C_2 685 768 1.1e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000192867
SMART Domains Protein: ENSMUSP00000141814
Gene: ENSMUSG00000045876

DomainStartEndE-ValueType
CA 26 104 7e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Meta Mutation Damage Score 0.0668 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 93.8%
Validation Efficiency 96% (86/90)
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik G T 10: 100,612,900 R158L possibly damaging Het
1700017N19Rik G A 10: 100,615,208 M179I probably benign Het
5430419D17Rik T G 7: 131,241,967 probably null Het
Abhd12 T C 2: 150,839,778 I231V possibly damaging Het
Adsl A G 15: 80,961,353 probably null Het
Ahnak C A 19: 9,013,767 N4138K possibly damaging Het
Ahnak T C 19: 9,018,211 S5620P probably damaging Het
Akap13 C T 7: 75,729,146 T2145I probably damaging Het
Alpk2 T A 18: 65,307,623 Q700L probably damaging Het
Apobec1 T C 6: 122,580,773 Y159C probably damaging Het
Atg9a T C 1: 75,186,272 T395A probably damaging Het
Atp6v1f A G 6: 29,467,958 I48V probably benign Het
BC051665 A C 13: 60,782,704 V278G probably damaging Het
Bicd1 A T 6: 149,513,703 H638L probably damaging Het
Cacna2d4 A G 6: 119,274,231 Y460C probably damaging Het
Ccdc157 C A 11: 4,144,538 R496L probably benign Het
Cep44 C G 8: 56,541,021 V174L probably damaging Het
Clca1 G T 3: 145,016,761 F283L possibly damaging Het
Csk T C 9: 57,630,302 T110A probably benign Het
Cspg4 T A 9: 56,885,222 probably null Het
Cutc A G 19: 43,760,029 I124V probably benign Het
Cyp2d9 A G 15: 82,455,524 T104A probably benign Het
Cyp2j9 G T 4: 96,577,714 T294K probably benign Het
D630003M21Rik T A 2: 158,204,657 probably null Het
Dcaf15 G T 8: 84,098,452 F450L probably damaging Het
Ddhd1 A T 14: 45,602,668 I723K probably damaging Het
Dnah17 C T 11: 118,114,213 A782T probably benign Het
Dnah3 T C 7: 120,078,501 D399G probably benign Het
Dync2h1 T C 9: 7,148,717 N909S probably benign Het
Erbin A G 13: 103,839,305 probably null Het
Fanci G A 7: 79,433,321 V682I probably benign Het
Fap A T 2: 62,573,503 F9L probably benign Het
Fat3 T C 9: 15,938,461 I3882V probably benign Het
Fkbp15 A T 4: 62,326,057 probably null Het
Fsd2 T C 7: 81,537,227 Y601C probably damaging Het
Gm5900 T C 7: 104,950,261 noncoding transcript Het
Gramd4 G T 15: 86,100,784 G82V probably damaging Het
Hc C T 2: 34,997,437 V1352I probably benign Het
Hsph1 A T 5: 149,625,158 N466K probably damaging Het
Ice2 T A 9: 69,408,262 D133E probably benign Het
Ifi213 T C 1: 173,568,979 M510V probably benign Het
Itpkb T G 1: 180,421,315 L861R probably damaging Het
Kbtbd3 T A 9: 4,330,476 D283E probably damaging Het
Man2a1 A G 17: 64,625,380 K154R probably benign Het
Masp1 T A 16: 23,491,927 I252F probably damaging Het
Megf11 G T 9: 64,685,964 C586F probably damaging Het
Myh2 C A 11: 67,192,719 A1476E possibly damaging Het
Myo18b A T 5: 112,802,330 probably null Het
Naip6 A T 13: 100,299,321 V898E possibly damaging Het
Nav1 T C 1: 135,585,146 M59V probably benign Het
Nlrp3 A T 11: 59,546,852 Y119F probably benign Het
Oxa1l T A 14: 54,363,301 I77N possibly damaging Het
Pdia5 A T 16: 35,422,965 W269R probably damaging Het
Peak1 T A 9: 56,207,338 T1440S probably benign Het
Piezo1 A G 8: 122,487,943 V1547A probably benign Het
Pkp1 T C 1: 135,882,521 Y437C probably damaging Het
Pla2r1 T C 2: 60,422,760 D1329G probably damaging Het
Ppip5k2 T C 1: 97,744,162 probably benign Het
Prrg4 C T 2: 104,845,033 S75N probably benign Het
Psmb9 T A 17: 34,182,292 I198F probably damaging Het
Rcbtb2 T A 14: 73,161,965 L23* probably null Het
Sbno1 A T 5: 124,386,791 probably benign Het
Scn3a T C 2: 65,514,695 E483G probably damaging Het
Sdccag8 T A 1: 176,824,822 D46E probably benign Het
Selenov A G 7: 28,288,154 F293L probably damaging Het
Sept2 A C 1: 93,479,301 D20A probably benign Het
Shc1 T A 3: 89,426,967 Y313* probably null Het
Siglec1 T A 2: 131,073,633 Y1346F probably damaging Het
Slc22a5 T A 11: 53,873,733 I296F probably damaging Het
Slc9c1 A G 16: 45,544,760 N152S probably damaging Het
Smoc1 C T 12: 81,104,757 R83* probably null Het
Ssx2ip A G 3: 146,427,831 D227G possibly damaging Het
Tbrg4 T C 11: 6,617,372 D576G probably damaging Het
Tbx20 T A 9: 24,758,859 Y226F probably damaging Het
Trav10d G T 14: 52,811,472 A107S probably damaging Het
Trim60 A T 8: 65,000,364 L411* probably null Het
Ttbk2 A T 2: 120,745,040 V1083D probably benign Het
Unc93a T A 17: 13,125,577 Q26L probably damaging Het
Usp14 T A 18: 10,022,819 N65I possibly damaging Het
Vip A T 10: 5,643,988 S114C probably damaging Het
Vmn1r237 A T 17: 21,314,551 I179F probably damaging Het
Wdr47 T A 3: 108,637,885 probably null Het
Zfp975 A T 7: 42,662,539 C217S probably damaging Het
Other mutations in Pcdhb8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Pcdhb8 APN 18 37355473 missense probably benign 0.00
IGL00574:Pcdhb8 APN 18 37356370 missense probably damaging 1.00
IGL00960:Pcdhb8 APN 18 37355973 missense probably benign 0.28
IGL01103:Pcdhb8 APN 18 37357200 missense probably damaging 1.00
IGL01330:Pcdhb8 APN 18 37357578 missense probably benign 0.12
IGL01413:Pcdhb8 APN 18 37355976 missense probably damaging 1.00
IGL01418:Pcdhb8 APN 18 37355976 missense probably damaging 1.00
IGL01608:Pcdhb8 APN 18 37356925 missense probably damaging 1.00
IGL02212:Pcdhb8 APN 18 37356412 missense possibly damaging 0.95
IGL02582:Pcdhb8 APN 18 37355374 missense possibly damaging 0.79
IGL02607:Pcdhb8 APN 18 37357581 missense probably benign 0.00
IGL02882:Pcdhb8 APN 18 37356223 missense possibly damaging 0.95
IGL03005:Pcdhb8 APN 18 37357534 missense probably damaging 1.00
IGL03108:Pcdhb8 APN 18 37357246 missense probably damaging 1.00
PIT4468001:Pcdhb8 UTSW 18 37356633 missense probably damaging 1.00
R0104:Pcdhb8 UTSW 18 37355665 missense probably benign 0.01
R0490:Pcdhb8 UTSW 18 37356780 missense probably damaging 1.00
R0617:Pcdhb8 UTSW 18 37357047 missense probably benign 0.02
R1168:Pcdhb8 UTSW 18 37356727 missense probably benign
R1189:Pcdhb8 UTSW 18 37356567 nonsense probably null
R1232:Pcdhb8 UTSW 18 37355775 missense probably benign 0.28
R1503:Pcdhb8 UTSW 18 37356519 missense probably damaging 1.00
R1576:Pcdhb8 UTSW 18 37356703 missense probably damaging 1.00
R1731:Pcdhb8 UTSW 18 37355838 missense probably damaging 1.00
R1908:Pcdhb8 UTSW 18 37355962 missense possibly damaging 0.84
R1909:Pcdhb8 UTSW 18 37355962 missense possibly damaging 0.84
R2215:Pcdhb8 UTSW 18 37357074 missense probably damaging 0.98
R3080:Pcdhb8 UTSW 18 37356166 missense probably damaging 1.00
R4394:Pcdhb8 UTSW 18 37356882 missense probably damaging 1.00
R4799:Pcdhb8 UTSW 18 37355653 missense probably damaging 1.00
R4845:Pcdhb8 UTSW 18 37356718 missense probably benign 0.43
R4879:Pcdhb8 UTSW 18 37356166 missense probably damaging 1.00
R4941:Pcdhb8 UTSW 18 37356006 missense probably benign 0.03
R5086:Pcdhb8 UTSW 18 37356106 missense probably damaging 1.00
R5416:Pcdhb8 UTSW 18 37356955 missense probably damaging 1.00
R5774:Pcdhb8 UTSW 18 37356685 missense probably damaging 1.00
R5935:Pcdhb8 UTSW 18 37356190 missense probably damaging 1.00
R6191:Pcdhb8 UTSW 18 37356226 missense probably benign
R6228:Pcdhb8 UTSW 18 37356984 missense probably benign 0.05
R6245:Pcdhb8 UTSW 18 37357169 missense possibly damaging 0.80
R6397:Pcdhb8 UTSW 18 37355463 nonsense probably null
R7469:Pcdhb8 UTSW 18 37355958 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCATGCTGCAGGTGCTAGTG -3'
(R):5'- CCAAGACACTCATTTGGATTCTG -3'

Sequencing Primer
(F):5'- TACCTGCCTCTGCCAGAG -3'
(R):5'- GTTATAGAATTGTAGGTCTTCCTGAC -3'
Posted On2017-02-15