Incidental Mutation 'R5899:Dock7'
ID457719
Institutional Source Beutler Lab
Gene Symbol Dock7
Ensembl Gene ENSMUSG00000028556
Gene Namededicator of cytokinesis 7
Synonyms3110056M06Rik, m, LOC242555
MMRRC Submission 044098-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5899 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location98936671-99120915 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 98991423 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 965 (C965S)
Ref Sequence ENSEMBL: ENSMUSP00000145604 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030286] [ENSMUST00000075836] [ENSMUST00000127417] [ENSMUST00000127946] [ENSMUST00000205650]
Predicted Effect probably benign
Transcript: ENSMUST00000030286
AA Change: C995S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000030286
Gene: ENSMUSG00000028556
AA Change: C995S

DomainStartEndE-ValueType
Pfam:DUF3398 67 159 6.5e-30 PFAM
coiled coil region 367 394 N/A INTRINSIC
low complexity region 493 504 N/A INTRINSIC
Pfam:DOCK-C2 557 736 1.8e-51 PFAM
low complexity region 789 799 N/A INTRINSIC
low complexity region 862 873 N/A INTRINSIC
low complexity region 888 901 N/A INTRINSIC
low complexity region 1135 1163 N/A INTRINSIC
low complexity region 1350 1364 N/A INTRINSIC
low complexity region 1543 1565 N/A INTRINSIC
Pfam:DHR-2 1571 2095 1.4e-217 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000075836
AA Change: C965S
SMART Domains Protein: ENSMUSP00000075233
Gene: ENSMUSG00000028556
AA Change: C965S

DomainStartEndE-ValueType
Pfam:DUF3398 65 159 5.8e-34 PFAM
coiled coil region 367 394 N/A INTRINSIC
low complexity region 493 504 N/A INTRINSIC
Pfam:DOCK-C2 556 737 3.3e-58 PFAM
low complexity region 789 799 N/A INTRINSIC
low complexity region 862 873 N/A INTRINSIC
low complexity region 888 901 N/A INTRINSIC
low complexity region 1105 1133 N/A INTRINSIC
low complexity region 1320 1334 N/A INTRINSIC
low complexity region 1513 1535 N/A INTRINSIC
Pfam:Ded_cyto 1888 2065 6.5e-80 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000124466
AA Change: C381S
Predicted Effect unknown
Transcript: ENSMUST00000127417
AA Change: C995S
SMART Domains Protein: ENSMUSP00000117797
Gene: ENSMUSG00000028556
AA Change: C995S

DomainStartEndE-ValueType
low complexity region 140 162 N/A INTRINSIC
Pfam:Ded_cyto 517 694 3e-80 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000127946
AA Change: C238S
SMART Domains Protein: ENSMUSP00000119103
Gene: ENSMUSG00000028556
AA Change: C238S

DomainStartEndE-ValueType
low complexity region 56 66 N/A INTRINSIC
low complexity region 129 140 N/A INTRINSIC
low complexity region 155 168 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000150254
AA Change: C219S
SMART Domains Protein: ENSMUSP00000114204
Gene: ENSMUSG00000028556
AA Change: C219S

DomainStartEndE-ValueType
low complexity region 74 84 N/A INTRINSIC
low complexity region 147 158 N/A INTRINSIC
low complexity region 173 186 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205650
AA Change: C965S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205783
Meta Mutation Damage Score 0.074 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.5%
Validation Efficiency 93% (56/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a guanine nucleotide exchange factor (GEF) that plays a role in axon formation and neuronal polarization. The encoded protein displays GEF activity toward RAC1 and RAC3 Rho small GTPases but not toward CDC42. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2012]
PHENOTYPE: Mice homozygous for mutations of this gene exhibit coat color dilution, white tail tip, and on some genetic backgrounds a white belly spot. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahi1 T C 10: 21,000,566 I792T probably benign Het
Anks1b T A 10: 90,923,517 probably null Het
Ano3 T G 2: 110,862,887 D122A probably benign Het
Atp12a T C 14: 56,373,344 V315A probably benign Het
B230104I21Rik G T 4: 154,349,529 G57* probably null Het
Bpifb2 A G 2: 153,891,130 K378E probably damaging Het
Cdk5rap2 T C 4: 70,243,593 probably benign Het
Cflar A G 1: 58,752,768 D410G probably benign Het
Clcn6 A G 4: 148,017,592 V345A probably benign Het
Cnga1 C T 5: 72,619,061 V20I possibly damaging Het
Ddx50 T A 10: 62,640,817 K226* probably null Het
Dnah5 T C 15: 28,448,367 V4192A possibly damaging Het
Dnah8 G A 17: 30,656,685 D494N probably benign Het
Dst C T 1: 34,295,289 A5083V probably damaging Het
E130208F15Rik T C 7: 30,322,301 Q10R probably damaging Het
Fbxw15 T C 9: 109,555,673 probably null Het
Fxr2 A G 11: 69,652,685 N671D probably damaging Het
Gbp7 A G 3: 142,546,542 T629A probably benign Het
Gm5155 A G 7: 17,917,444 D840G possibly damaging Het
Grm1 T C 10: 10,689,348 Y1072C probably benign Het
Hmcn2 A T 2: 31,354,673 E714V possibly damaging Het
Hsd17b13 T A 5: 103,965,864 E205D probably benign Het
Igf2bp3 A G 6: 49,117,150 probably benign Het
Il2ra A G 2: 11,684,437 H259R probably benign Het
Klk15 G T 7: 43,938,823 R185L probably benign Het
Map3k11 T G 19: 5,695,909 probably null Het
Morn3 A G 5: 123,041,103 W95R probably damaging Het
Nipbl A G 15: 8,334,844 probably null Het
Nrap A T 19: 56,340,574 V1145D possibly damaging Het
Olfr168 C T 16: 19,530,801 G40R probably damaging Het
Olfr395 A G 11: 73,906,929 S188P probably damaging Het
Olfr825 T A 10: 130,162,673 I218F probably benign Het
Pdcd11 A G 19: 47,104,759 N492S possibly damaging Het
Ptgfr C T 3: 151,835,101 V257I probably damaging Het
Racgap1 T C 15: 99,623,628 E549G possibly damaging Het
Rfx3 T C 19: 27,830,765 T193A probably damaging Het
Rplp0 T A 5: 115,561,430 I149N probably benign Het
Samd7 T G 3: 30,756,734 I300S probably benign Het
Scpep1 A G 11: 88,934,576 probably null Het
Senp6 T C 9: 80,142,070 probably benign Het
Serpinb2 G T 1: 107,519,716 G78V probably damaging Het
Sesn1 T C 10: 41,811,193 S58P probably benign Het
Spg11 T C 2: 122,098,199 D591G possibly damaging Het
Spire2 A C 8: 123,354,094 S26R probably damaging Het
Strip2 T A 6: 29,956,958 probably benign Het
Ttc37 A G 13: 76,111,819 probably null Het
Ttn G A 2: 76,867,175 probably benign Het
Vmn2r77 A G 7: 86,811,716 Y750C probably damaging Het
Wnt11 T A 7: 98,839,176 Y23* probably null Het
Zbp1 T A 2: 173,210,547 D272V probably benign Het
Other mutations in Dock7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Dock7 APN 4 99063985 missense probably damaging 1.00
IGL01126:Dock7 APN 4 98973552 splice site probably benign
IGL01490:Dock7 APN 4 98945118 unclassified probably benign
IGL01553:Dock7 APN 4 98945566 nonsense probably null
IGL01728:Dock7 APN 4 98962331 missense probably damaging 1.00
IGL01776:Dock7 APN 4 98940941 missense possibly damaging 0.65
IGL01954:Dock7 APN 4 99083151 missense probably damaging 0.99
IGL01985:Dock7 APN 4 99023377 missense probably benign 0.35
IGL02054:Dock7 APN 4 98973409 missense probably damaging 1.00
IGL02150:Dock7 APN 4 99079852 splice site probably benign
IGL02153:Dock7 APN 4 98958067 missense probably benign 0.15
IGL02183:Dock7 APN 4 98958991 missense possibly damaging 0.89
IGL02494:Dock7 APN 4 98989234 missense probably benign 0.18
IGL02618:Dock7 APN 4 99083028 missense probably benign 0.00
IGL02634:Dock7 APN 4 98989296 missense probably damaging 1.00
IGL02670:Dock7 APN 4 98966286 splice site probably null
IGL02690:Dock7 APN 4 98969635 missense possibly damaging 0.95
IGL02692:Dock7 APN 4 98987386 missense probably damaging 1.00
IGL02833:Dock7 APN 4 98945495 missense probably damaging 1.00
IGL02858:Dock7 APN 4 98945205 nonsense probably null
IGL02875:Dock7 APN 4 98975994 missense probably benign 0.00
IGL03027:Dock7 APN 4 98977927 missense probably benign
IGL03027:Dock7 APN 4 99070213 missense possibly damaging 0.71
IGL03032:Dock7 APN 4 98966348 missense probably benign 0.02
IGL03104:Dock7 APN 4 98959023 missense possibly damaging 0.60
IGL03136:Dock7 APN 4 99003791 missense probably damaging 1.00
IGL03345:Dock7 APN 4 98984819 missense possibly damaging 0.91
moonlight UTSW 4 large deletion
PIT4810001:Dock7 UTSW 4 98945559 nonsense probably null
R0086:Dock7 UTSW 4 98945144 missense probably damaging 1.00
R0242:Dock7 UTSW 4 98962280 missense probably benign
R0242:Dock7 UTSW 4 98962280 missense probably benign
R0245:Dock7 UTSW 4 99055349 missense possibly damaging 0.64
R0308:Dock7 UTSW 4 98984814 missense probably benign 0.07
R0556:Dock7 UTSW 4 98945189 missense probably damaging 1.00
R0612:Dock7 UTSW 4 98989233 missense probably benign 0.31
R0652:Dock7 UTSW 4 99055349 missense possibly damaging 0.64
R0669:Dock7 UTSW 4 98987479 missense probably benign 0.00
R0681:Dock7 UTSW 4 99016704 missense probably damaging 1.00
R0725:Dock7 UTSW 4 98945291 missense probably damaging 1.00
R0828:Dock7 UTSW 4 99015745 missense probably damaging 1.00
R0837:Dock7 UTSW 4 98989258 missense probably benign 0.01
R0962:Dock7 UTSW 4 98945195 missense possibly damaging 0.85
R1140:Dock7 UTSW 4 99065406 missense possibly damaging 0.82
R1476:Dock7 UTSW 4 99079435 missense possibly damaging 0.52
R1614:Dock7 UTSW 4 99061280 missense probably benign 0.12
R1625:Dock7 UTSW 4 98962196 splice site probably null
R1640:Dock7 UTSW 4 98945246 missense probably damaging 1.00
R1752:Dock7 UTSW 4 98966444 missense probably damaging 1.00
R1941:Dock7 UTSW 4 98984715 missense probably benign 0.09
R2020:Dock7 UTSW 4 98959101 missense probably damaging 1.00
R2092:Dock7 UTSW 4 99009308 missense possibly damaging 0.95
R2293:Dock7 UTSW 4 98966369 missense probably damaging 1.00
R2424:Dock7 UTSW 4 98945307 nonsense probably null
R3767:Dock7 UTSW 4 98970829 missense probably benign
R3768:Dock7 UTSW 4 98970829 missense probably benign
R3769:Dock7 UTSW 4 98970829 missense probably benign
R3770:Dock7 UTSW 4 98970829 missense probably benign
R3917:Dock7 UTSW 4 99016685 missense probably damaging 1.00
R3943:Dock7 UTSW 4 98992431 missense probably damaging 1.00
R4021:Dock7 UTSW 4 99003920 splice site probably null
R4073:Dock7 UTSW 4 99008059 missense probably benign 0.02
R4170:Dock7 UTSW 4 98966401 missense probably damaging 0.99
R4180:Dock7 UTSW 4 99016736 missense probably benign 0.05
R4261:Dock7 UTSW 4 99003886 missense possibly damaging 0.78
R4321:Dock7 UTSW 4 99072454 missense probably damaging 1.00
R4522:Dock7 UTSW 4 98962224 missense probably damaging 1.00
R4582:Dock7 UTSW 4 99003916 missense possibly damaging 0.90
R4648:Dock7 UTSW 4 98969644 nonsense probably null
R4940:Dock7 UTSW 4 99020077 missense probably damaging 1.00
R5090:Dock7 UTSW 4 98991411 missense probably benign 0.04
R5374:Dock7 UTSW 4 98989038 missense possibly damaging 0.81
R5392:Dock7 UTSW 4 99008006 missense probably damaging 1.00
R5527:Dock7 UTSW 4 98953868 intron probably benign
R5544:Dock7 UTSW 4 98967257 missense probably damaging 1.00
R5556:Dock7 UTSW 4 98944735 missense probably damaging 1.00
R5870:Dock7 UTSW 4 99063962 missense probably benign 0.00
R6360:Dock7 UTSW 4 98969662 missense probably benign 0.02
R6415:Dock7 UTSW 4 98992448 missense probably damaging 1.00
R6468:Dock7 UTSW 4 98967227 missense probably benign 0.15
R6562:Dock7 UTSW 4 98991410 missense probably damaging 0.97
R6613:Dock7 UTSW 4 98977960 missense probably damaging 0.99
R6703:Dock7 UTSW 4 98946672 missense probably damaging 1.00
R6723:Dock7 UTSW 4 99003916 missense possibly damaging 0.90
R6786:Dock7 UTSW 4 99061292 missense probably benign 0.42
R7026:Dock7 UTSW 4 99078919 missense probably benign
R7051:Dock7 UTSW 4 98946732 missense probably damaging 1.00
R7074:Dock7 UTSW 4 98945208 missense unknown
R7106:Dock7 UTSW 4 98967326 missense unknown
R7147:Dock7 UTSW 4 98961417 missense unknown
R7257:Dock7 UTSW 4 98973412 missense unknown
X0027:Dock7 UTSW 4 99003853 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATATTGTGTTGGTACCCATGGCC -3'
(R):5'- ATGGGTGTGTCCATGACATCATC -3'

Sequencing Primer
(F):5'- GGTACCCATGGCCTATATTTAGAAGC -3'
(R):5'- GTGTGTCCATGACATCATCCAGTG -3'
Posted On2017-02-15