Incidental Mutation 'R5899:Senp6'
ID457733
Institutional Source Beutler Lab
Gene Symbol Senp6
Ensembl Gene ENSMUSG00000034252
Gene NameSUMO/sentrin specific peptidase 6
SynonymsE130319N12Rik, 2810017C20Rik
MMRRC Submission 044098-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5899 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location80066903-80144953 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 80142070 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000135401 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037484] [ENSMUST00000164859] [ENSMUST00000165607] [ENSMUST00000175999]
Predicted Effect probably benign
Transcript: ENSMUST00000037484
SMART Domains Protein: ENSMUSP00000047220
Gene: ENSMUSG00000034252

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
ZnF_C2HC 242 260 7.23e0 SMART
Pfam:Peptidase_C48 700 826 3.5e-23 PFAM
Pfam:Peptidase_C48 965 1096 1.1e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164859
SMART Domains Protein: ENSMUSP00000128918
Gene: ENSMUSG00000034252

DomainStartEndE-ValueType
ZnF_C2HC 76 94 7.23e0 SMART
Pfam:Peptidase_C48 534 660 5.2e-23 PFAM
Pfam:Peptidase_C48 799 930 1.6e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165607
SMART Domains Protein: ENSMUSP00000126777
Gene: ENSMUSG00000034252

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
ZnF_C2HC 249 267 7.23e0 SMART
Pfam:Peptidase_C48 707 833 3.4e-23 PFAM
Pfam:Peptidase_C48 972 1103 1.1e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175722
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175758
Predicted Effect probably benign
Transcript: ENSMUST00000175999
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176563
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176607
SMART Domains Protein: ENSMUSP00000135231
Gene: ENSMUSG00000034252

DomainStartEndE-ValueType
ZnF_C2HC 76 94 7.23e0 SMART
Pfam:Peptidase_C48 534 660 4.9e-23 PFAM
Pfam:Peptidase_C48 799 911 2.1e-14 PFAM
Meta Mutation Damage Score 0.0656 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.5%
Validation Efficiency 93% (56/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ubiquitin-like molecules (UBLs), such as SUMO1 (UBL1; MIM 601912), are structurally related to ubiquitin (MIM 191339) and can be ligated to target proteins in a similar manner as ubiquitin. However, covalent attachment of UBLs does not result in degradation of the modified proteins. SUMO1 modification is implicated in the targeting of RANGAP1 (MIM 602362) to the nuclear pore complex, as well as in stabilization of I-kappa-B-alpha (NFKBIA; MIM 164008) from degradation by the 26S proteasome. Like ubiquitin, UBLs are synthesized as precursor proteins, with 1 or more amino acids following the C-terminal glycine-glycine residues of the mature UBL protein. Thus, the tail sequences of the UBL precursors need to be removed by UBL-specific proteases, such as SENP6, prior to their conjugation to target proteins (Kim et al., 2000 [PubMed 10799485]). SENPs also display isopeptidase activity for deconjugation of SUMO-conjugated substrates (Lima and Reverter, 2008 [PubMed 18799455]).[supplied by OMIM, Jun 2009]
PHENOTYPE: Mice homozygous for a gene trap insertion exhibit prenatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahi1 T C 10: 21,000,566 I792T probably benign Het
Anks1b T A 10: 90,923,517 probably null Het
Ano3 T G 2: 110,862,887 D122A probably benign Het
Atp12a T C 14: 56,373,344 V315A probably benign Het
B230104I21Rik G T 4: 154,349,529 G57* probably null Het
Bpifb2 A G 2: 153,891,130 K378E probably damaging Het
Cdk5rap2 T C 4: 70,243,593 probably benign Het
Cflar A G 1: 58,752,768 D410G probably benign Het
Clcn6 A G 4: 148,017,592 V345A probably benign Het
Cnga1 C T 5: 72,619,061 V20I possibly damaging Het
Ddx50 T A 10: 62,640,817 K226* probably null Het
Dnah5 T C 15: 28,448,367 V4192A possibly damaging Het
Dnah8 G A 17: 30,656,685 D494N probably benign Het
Dock7 A T 4: 98,991,423 C965S probably benign Het
Dst C T 1: 34,295,289 A5083V probably damaging Het
E130208F15Rik T C 7: 30,322,301 Q10R probably damaging Het
Fbxw15 T C 9: 109,555,673 probably null Het
Fxr2 A G 11: 69,652,685 N671D probably damaging Het
Gbp7 A G 3: 142,546,542 T629A probably benign Het
Gm5155 A G 7: 17,917,444 D840G possibly damaging Het
Grm1 T C 10: 10,689,348 Y1072C probably benign Het
Hmcn2 A T 2: 31,354,673 E714V possibly damaging Het
Hsd17b13 T A 5: 103,965,864 E205D probably benign Het
Igf2bp3 A G 6: 49,117,150 probably benign Het
Il2ra A G 2: 11,684,437 H259R probably benign Het
Klk15 G T 7: 43,938,823 R185L probably benign Het
Map3k11 T G 19: 5,695,909 probably null Het
Morn3 A G 5: 123,041,103 W95R probably damaging Het
Nipbl A G 15: 8,334,844 probably null Het
Nrap A T 19: 56,340,574 V1145D possibly damaging Het
Olfr168 C T 16: 19,530,801 G40R probably damaging Het
Olfr395 A G 11: 73,906,929 S188P probably damaging Het
Olfr825 T A 10: 130,162,673 I218F probably benign Het
Pdcd11 A G 19: 47,104,759 N492S possibly damaging Het
Ptgfr C T 3: 151,835,101 V257I probably damaging Het
Racgap1 T C 15: 99,623,628 E549G possibly damaging Het
Rfx3 T C 19: 27,830,765 T193A probably damaging Het
Rplp0 T A 5: 115,561,430 I149N probably benign Het
Samd7 T G 3: 30,756,734 I300S probably benign Het
Scpep1 A G 11: 88,934,576 probably null Het
Serpinb2 G T 1: 107,519,716 G78V probably damaging Het
Sesn1 T C 10: 41,811,193 S58P probably benign Het
Spg11 T C 2: 122,098,199 D591G possibly damaging Het
Spire2 A C 8: 123,354,094 S26R probably damaging Het
Strip2 T A 6: 29,956,958 probably benign Het
Ttc37 A G 13: 76,111,819 probably null Het
Ttn G A 2: 76,867,175 probably benign Het
Vmn2r77 A G 7: 86,811,716 Y750C probably damaging Het
Wnt11 T A 7: 98,839,176 Y23* probably null Het
Zbp1 T A 2: 173,210,547 D272V probably benign Het
Other mutations in Senp6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Senp6 APN 9 80116610 missense probably damaging 1.00
IGL00487:Senp6 APN 9 80113838 missense probably damaging 1.00
IGL01285:Senp6 APN 9 80136718 missense probably benign 0.05
IGL01337:Senp6 APN 9 80136510 missense probably damaging 0.97
IGL01563:Senp6 APN 9 80122008 missense probably benign
IGL01633:Senp6 APN 9 80092394 missense probably damaging 1.00
IGL02115:Senp6 APN 9 80121926 missense probably damaging 1.00
IGL02208:Senp6 APN 9 80113943 missense probably damaging 1.00
IGL02378:Senp6 APN 9 80126392 missense probably damaging 1.00
A4554:Senp6 UTSW 9 80148458 unclassified probably benign
R0031:Senp6 UTSW 9 80126243 missense probably damaging 1.00
R0121:Senp6 UTSW 9 80116670 missense probably benign 0.01
R0276:Senp6 UTSW 9 80136747 missense probably benign
R0294:Senp6 UTSW 9 80113725 unclassified probably null
R0308:Senp6 UTSW 9 80132983 critical splice donor site probably null
R0531:Senp6 UTSW 9 80123884 missense probably damaging 0.99
R0743:Senp6 UTSW 9 80093589 missense probably damaging 1.00
R0883:Senp6 UTSW 9 80116559 missense probably damaging 1.00
R1071:Senp6 UTSW 9 80136729 missense probably benign 0.35
R1171:Senp6 UTSW 9 80116725 missense possibly damaging 0.89
R1340:Senp6 UTSW 9 80122023 missense possibly damaging 0.47
R1571:Senp6 UTSW 9 80093571 missense probably damaging 1.00
R1760:Senp6 UTSW 9 80118629 missense probably benign 0.36
R1909:Senp6 UTSW 9 80113774 missense possibly damaging 0.67
R2008:Senp6 UTSW 9 80126398 missense probably damaging 1.00
R2067:Senp6 UTSW 9 80089869 missense probably benign 0.11
R2077:Senp6 UTSW 9 80126155 missense probably benign 0.14
R2141:Senp6 UTSW 9 80123820 missense probably damaging 1.00
R2321:Senp6 UTSW 9 80123740 missense possibly damaging 0.83
R2760:Senp6 UTSW 9 80121978 missense probably null
R2939:Senp6 UTSW 9 80143842 missense probably benign 0.00
R2940:Senp6 UTSW 9 80143842 missense probably benign 0.00
R3081:Senp6 UTSW 9 80143842 missense probably benign 0.00
R3784:Senp6 UTSW 9 80092286 missense probably benign 0.16
R3785:Senp6 UTSW 9 80092286 missense probably benign 0.16
R3800:Senp6 UTSW 9 80087453 missense possibly damaging 0.89
R3857:Senp6 UTSW 9 80092321 missense possibly damaging 0.85
R4790:Senp6 UTSW 9 80089858 missense probably benign 0.20
R5117:Senp6 UTSW 9 80130746 missense probably damaging 1.00
R5418:Senp6 UTSW 9 80121869 missense possibly damaging 0.89
R5477:Senp6 UTSW 9 80143843 missense probably damaging 1.00
R5582:Senp6 UTSW 9 80089876 missense possibly damaging 0.91
R5717:Senp6 UTSW 9 80092312 missense probably damaging 0.99
R5800:Senp6 UTSW 9 80126433 missense probably damaging 1.00
R5802:Senp6 UTSW 9 80118644 unclassified probably benign
R5918:Senp6 UTSW 9 80114116 critical splice donor site probably null
R5958:Senp6 UTSW 9 80142294 missense probably damaging 1.00
R6360:Senp6 UTSW 9 80113806 missense probably benign
R6477:Senp6 UTSW 9 80093625 nonsense probably null
R6628:Senp6 UTSW 9 80132954 missense probably damaging 1.00
R6703:Senp6 UTSW 9 80121921 missense probably damaging 1.00
R7236:Senp6 UTSW 9 80132965 missense probably damaging 1.00
R7268:Senp6 UTSW 9 80142124 missense probably damaging 1.00
R7290:Senp6 UTSW 9 80136515 missense probably benign 0.25
R7319:Senp6 UTSW 9 80126199 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTCGAGTTTCATTACTATTCTGTAGC -3'
(R):5'- GGACCCTTTCATAACATCTTTGG -3'

Sequencing Primer
(F):5'- TGTAGCAATGTTTAATGTTACCAGAG -3'
(R):5'- CCCTTTCATAACATCTTTGGAAAAAC -3'
Posted On2017-02-15