Incidental Mutation 'R5899:Olfr825'
ID457741
Institutional Source Beutler Lab
Gene Symbol Olfr825
Ensembl Gene ENSMUSG00000058084
Gene Nameolfactory receptor 825
SynonymsGA_x6K02T2PULF-11834065-11833103, MOR210-1
MMRRC Submission 044098-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.281) question?
Stock #R5899 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location130159732-130166766 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 130162673 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 218 (I218F)
Ref Sequence ENSEMBL: ENSMUSP00000149981 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076814] [ENSMUST00000216530]
Predicted Effect probably benign
Transcript: ENSMUST00000076814
AA Change: I218F

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000076091
Gene: ENSMUSG00000058084
AA Change: I218F

DomainStartEndE-ValueType
Pfam:7tm_4 34 309 8.8e-54 PFAM
Pfam:7TM_GPCR_Srsx 38 251 9.6e-6 PFAM
Pfam:7tm_1 44 291 2e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216434
Predicted Effect probably benign
Transcript: ENSMUST00000216530
AA Change: I218F

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218167
Meta Mutation Damage Score 0.1548 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.5%
Validation Efficiency 93% (56/60)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahi1 T C 10: 21,000,566 I792T probably benign Het
Anks1b T A 10: 90,923,517 probably null Het
Ano3 T G 2: 110,862,887 D122A probably benign Het
Atp12a T C 14: 56,373,344 V315A probably benign Het
B230104I21Rik G T 4: 154,349,529 G57* probably null Het
Bpifb2 A G 2: 153,891,130 K378E probably damaging Het
Cdk5rap2 T C 4: 70,243,593 probably benign Het
Cflar A G 1: 58,752,768 D410G probably benign Het
Clcn6 A G 4: 148,017,592 V345A probably benign Het
Cnga1 C T 5: 72,619,061 V20I possibly damaging Het
Ddx50 T A 10: 62,640,817 K226* probably null Het
Dnah5 T C 15: 28,448,367 V4192A possibly damaging Het
Dnah8 G A 17: 30,656,685 D494N probably benign Het
Dock7 A T 4: 98,991,423 C965S probably benign Het
Dst C T 1: 34,295,289 A5083V probably damaging Het
E130208F15Rik T C 7: 30,322,301 Q10R probably damaging Het
Fbxw15 T C 9: 109,555,673 probably null Het
Fxr2 A G 11: 69,652,685 N671D probably damaging Het
Gbp7 A G 3: 142,546,542 T629A probably benign Het
Gm5155 A G 7: 17,917,444 D840G possibly damaging Het
Grm1 T C 10: 10,689,348 Y1072C probably benign Het
Hmcn2 A T 2: 31,354,673 E714V possibly damaging Het
Hsd17b13 T A 5: 103,965,864 E205D probably benign Het
Igf2bp3 A G 6: 49,117,150 probably benign Het
Il2ra A G 2: 11,684,437 H259R probably benign Het
Klk15 G T 7: 43,938,823 R185L probably benign Het
Map3k11 T G 19: 5,695,909 probably null Het
Morn3 A G 5: 123,041,103 W95R probably damaging Het
Nipbl A G 15: 8,334,844 probably null Het
Nrap A T 19: 56,340,574 V1145D possibly damaging Het
Olfr168 C T 16: 19,530,801 G40R probably damaging Het
Olfr395 A G 11: 73,906,929 S188P probably damaging Het
Pdcd11 A G 19: 47,104,759 N492S possibly damaging Het
Ptgfr C T 3: 151,835,101 V257I probably damaging Het
Racgap1 T C 15: 99,623,628 E549G possibly damaging Het
Rfx3 T C 19: 27,830,765 T193A probably damaging Het
Rplp0 T A 5: 115,561,430 I149N probably benign Het
Samd7 T G 3: 30,756,734 I300S probably benign Het
Scpep1 A G 11: 88,934,576 probably null Het
Senp6 T C 9: 80,142,070 probably benign Het
Serpinb2 G T 1: 107,519,716 G78V probably damaging Het
Sesn1 T C 10: 41,811,193 S58P probably benign Het
Spg11 T C 2: 122,098,199 D591G possibly damaging Het
Spire2 A C 8: 123,354,094 S26R probably damaging Het
Strip2 T A 6: 29,956,958 probably benign Het
Ttc37 A G 13: 76,111,819 probably null Het
Ttn G A 2: 76,867,175 probably benign Het
Vmn2r77 A G 7: 86,811,716 Y750C probably damaging Het
Wnt11 T A 7: 98,839,176 Y23* probably null Het
Zbp1 T A 2: 173,210,547 D272V probably benign Het
Other mutations in Olfr825
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03244:Olfr825 APN 10 130162400 nonsense probably null
R1120:Olfr825 UTSW 10 130162537 missense probably damaging 1.00
R1341:Olfr825 UTSW 10 130163316 missense probably benign 0.00
R1754:Olfr825 UTSW 10 130163164 missense probably benign 0.02
R2022:Olfr825 UTSW 10 130163180 missense probably benign 0.00
R2027:Olfr825 UTSW 10 130162735 missense probably benign 0.00
R3838:Olfr825 UTSW 10 130162406 nonsense probably null
R3842:Olfr825 UTSW 10 130162901 missense probably benign 0.00
R4737:Olfr825 UTSW 10 130162838 missense probably benign 0.01
R5166:Olfr825 UTSW 10 130162561 missense possibly damaging 0.60
R5744:Olfr825 UTSW 10 130162792 missense possibly damaging 0.92
X0026:Olfr825 UTSW 10 130162731 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATCAGAGGGTTCAGCATAGGTG -3'
(R):5'- TCAGCTCTGTTCTCCAGACTAG -3'

Sequencing Primer
(F):5'- TCAGCATAGGTGTGACTAGGG -3'
(R):5'- TGTTCTCCAGACTAGCATGAC -3'
Posted On2017-02-15