Incidental Mutation 'R5899:Ttc37'
ID457745
Institutional Source Beutler Lab
Gene Symbol Ttc37
Ensembl Gene ENSMUSG00000033991
Gene Nametetratricopeptide repeat domain 37
Synonyms
MMRRC Submission 044098-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.417) question?
Stock #R5899 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location76098734-76190316 bp(+) (GRCm38)
Type of Mutationsplice site (3 bp from exon)
DNA Base Change (assembly) A to G at 76111819 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000153521 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091466] [ENSMUST00000224386]
Predicted Effect probably null
Transcript: ENSMUST00000091466
SMART Domains Protein: ENSMUSP00000089045
Gene: ENSMUSG00000033991

DomainStartEndE-ValueType
TPR 6 39 2.92e1 SMART
TPR 40 73 1.1e-1 SMART
TPR 272 305 9.45e0 SMART
TPR 306 339 8.9e-2 SMART
SEL1 420 451 1.45e2 SMART
TPR 420 453 2.55e-2 SMART
SEL1 454 490 1.15e1 SMART
TPR 454 492 2.84e1 SMART
TPR 493 527 1.92e1 SMART
TPR 564 597 7.34e-3 SMART
TPR 598 631 1.81e-2 SMART
TPR 632 665 2.43e1 SMART
low complexity region 728 739 N/A INTRINSIC
SEL1 861 892 3.58e1 SMART
TPR 861 894 2.14e-4 SMART
TPR 980 1013 1.56e1 SMART
Blast:TPR 1051 1084 7e-11 BLAST
Blast:TPR 1088 1121 7e-10 BLAST
TPR 1399 1432 4.31e0 SMART
low complexity region 1438 1450 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000224386
Predicted Effect probably benign
Transcript: ENSMUST00000224790
Meta Mutation Damage Score 0.6416 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.5%
Validation Efficiency 93% (56/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with twenty tetratricopeptide (TPR) repeats. Tetratricopeptide repeat containing motifs are found in a variety of proteins and may mediate protein-protein interactions and chaperone activity. Mutations in this gene are associated with trichohepatoenteric syndrome. [provided by RefSeq, Jul 2010]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahi1 T C 10: 21,000,566 I792T probably benign Het
Anks1b T A 10: 90,923,517 probably null Het
Ano3 T G 2: 110,862,887 D122A probably benign Het
Atp12a T C 14: 56,373,344 V315A probably benign Het
B230104I21Rik G T 4: 154,349,529 G57* probably null Het
Bpifb2 A G 2: 153,891,130 K378E probably damaging Het
Cdk5rap2 T C 4: 70,243,593 probably benign Het
Cflar A G 1: 58,752,768 D410G probably benign Het
Clcn6 A G 4: 148,017,592 V345A probably benign Het
Cnga1 C T 5: 72,619,061 V20I possibly damaging Het
Ddx50 T A 10: 62,640,817 K226* probably null Het
Dnah5 T C 15: 28,448,367 V4192A possibly damaging Het
Dnah8 G A 17: 30,656,685 D494N probably benign Het
Dock7 A T 4: 98,991,423 C965S probably benign Het
Dst C T 1: 34,295,289 A5083V probably damaging Het
E130208F15Rik T C 7: 30,322,301 Q10R probably damaging Het
Fbxw15 T C 9: 109,555,673 probably null Het
Fxr2 A G 11: 69,652,685 N671D probably damaging Het
Gbp7 A G 3: 142,546,542 T629A probably benign Het
Gm5155 A G 7: 17,917,444 D840G possibly damaging Het
Grm1 T C 10: 10,689,348 Y1072C probably benign Het
Hmcn2 A T 2: 31,354,673 E714V possibly damaging Het
Hsd17b13 T A 5: 103,965,864 E205D probably benign Het
Igf2bp3 A G 6: 49,117,150 probably benign Het
Il2ra A G 2: 11,684,437 H259R probably benign Het
Klk15 G T 7: 43,938,823 R185L probably benign Het
Map3k11 T G 19: 5,695,909 probably null Het
Morn3 A G 5: 123,041,103 W95R probably damaging Het
Nipbl A G 15: 8,334,844 probably null Het
Nrap A T 19: 56,340,574 V1145D possibly damaging Het
Olfr168 C T 16: 19,530,801 G40R probably damaging Het
Olfr395 A G 11: 73,906,929 S188P probably damaging Het
Olfr825 T A 10: 130,162,673 I218F probably benign Het
Pdcd11 A G 19: 47,104,759 N492S possibly damaging Het
Ptgfr C T 3: 151,835,101 V257I probably damaging Het
Racgap1 T C 15: 99,623,628 E549G possibly damaging Het
Rfx3 T C 19: 27,830,765 T193A probably damaging Het
Rplp0 T A 5: 115,561,430 I149N probably benign Het
Samd7 T G 3: 30,756,734 I300S probably benign Het
Scpep1 A G 11: 88,934,576 probably null Het
Senp6 T C 9: 80,142,070 probably benign Het
Serpinb2 G T 1: 107,519,716 G78V probably damaging Het
Sesn1 T C 10: 41,811,193 S58P probably benign Het
Spg11 T C 2: 122,098,199 D591G possibly damaging Het
Spire2 A C 8: 123,354,094 S26R probably damaging Het
Strip2 T A 6: 29,956,958 probably benign Het
Ttn G A 2: 76,867,175 probably benign Het
Vmn2r77 A G 7: 86,811,716 Y750C probably damaging Het
Wnt11 T A 7: 98,839,176 Y23* probably null Het
Zbp1 T A 2: 173,210,547 D272V probably benign Het
Other mutations in Ttc37
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Ttc37 APN 13 76143278 critical splice donor site probably null
IGL00650:Ttc37 APN 13 76127507 missense possibly damaging 0.89
IGL00838:Ttc37 APN 13 76134791 missense probably damaging 0.99
IGL00958:Ttc37 APN 13 76122745 missense probably damaging 0.98
IGL01011:Ttc37 APN 13 76122665 missense probably damaging 0.97
IGL01062:Ttc37 APN 13 76155462 nonsense probably null
IGL01319:Ttc37 APN 13 76129379 missense probably benign 0.29
IGL01697:Ttc37 APN 13 76128733 missense probably benign 0.01
IGL02061:Ttc37 APN 13 76129541 critical splice donor site probably null
IGL02184:Ttc37 APN 13 76111691 missense probably damaging 1.00
IGL02309:Ttc37 APN 13 76127047 missense possibly damaging 0.90
IGL03230:Ttc37 APN 13 76155647 splice site probably benign
IGL03354:Ttc37 APN 13 76182822 missense possibly damaging 0.71
caviar UTSW 13 76147767 missense possibly damaging 0.54
gourmet UTSW 13 76150519 missense probably damaging 1.00
tartare UTSW 13 76185179 missense probably damaging 0.96
R0501:Ttc37 UTSW 13 76147806 missense probably benign
R0628:Ttc37 UTSW 13 76150729 missense possibly damaging 0.89
R0711:Ttc37 UTSW 13 76182891 missense probably damaging 1.00
R0928:Ttc37 UTSW 13 76113592 missense probably damaging 1.00
R1402:Ttc37 UTSW 13 76131414 missense probably damaging 1.00
R1402:Ttc37 UTSW 13 76131414 missense probably damaging 1.00
R1524:Ttc37 UTSW 13 76138372 missense probably benign 0.01
R1628:Ttc37 UTSW 13 76111791 missense possibly damaging 0.75
R1702:Ttc37 UTSW 13 76122743 missense possibly damaging 0.66
R1750:Ttc37 UTSW 13 76140601 missense possibly damaging 0.89
R1822:Ttc37 UTSW 13 76130288 missense probably benign 0.35
R1885:Ttc37 UTSW 13 76113047 missense probably benign 0.00
R1885:Ttc37 UTSW 13 76130235 missense probably benign 0.11
R1923:Ttc37 UTSW 13 76134770 missense probably damaging 1.00
R1978:Ttc37 UTSW 13 76134815 missense probably benign 0.00
R2040:Ttc37 UTSW 13 76180103 missense probably damaging 1.00
R2136:Ttc37 UTSW 13 76173354 missense possibly damaging 0.87
R2268:Ttc37 UTSW 13 76112274 unclassified probably benign
R2483:Ttc37 UTSW 13 76182867 missense probably damaging 1.00
R2988:Ttc37 UTSW 13 76155689 missense probably benign 0.11
R3701:Ttc37 UTSW 13 76113679 missense probably benign
R3951:Ttc37 UTSW 13 76130219 missense probably damaging 1.00
R4405:Ttc37 UTSW 13 76155665 missense probably damaging 0.97
R4411:Ttc37 UTSW 13 76127504 missense possibly damaging 0.89
R4957:Ttc37 UTSW 13 76185113 unclassified probably null
R4960:Ttc37 UTSW 13 76185156 missense possibly damaging 0.95
R4993:Ttc37 UTSW 13 76182936 missense probably damaging 0.96
R5206:Ttc37 UTSW 13 76147767 missense possibly damaging 0.54
R5208:Ttc37 UTSW 13 76147767 missense possibly damaging 0.54
R5302:Ttc37 UTSW 13 76147767 missense possibly damaging 0.54
R5305:Ttc37 UTSW 13 76147767 missense possibly damaging 0.54
R5306:Ttc37 UTSW 13 76147767 missense possibly damaging 0.54
R5579:Ttc37 UTSW 13 76185200 missense probably damaging 1.00
R5618:Ttc37 UTSW 13 76173426 missense probably benign
R5726:Ttc37 UTSW 13 76118347 missense probably damaging 1.00
R5813:Ttc37 UTSW 13 76155733 missense probably benign 0.05
R6146:Ttc37 UTSW 13 76185240 missense probably damaging 1.00
R6224:Ttc37 UTSW 13 76118291 missense probably benign 0.02
R6286:Ttc37 UTSW 13 76143240 missense probably damaging 1.00
R6402:Ttc37 UTSW 13 76135270 missense probably benign 0.05
R6561:Ttc37 UTSW 13 76150519 missense probably damaging 1.00
R6808:Ttc37 UTSW 13 76185179 missense probably damaging 0.96
R7054:Ttc37 UTSW 13 76134960 missense probably damaging 1.00
R7261:Ttc37 UTSW 13 76113579 missense probably benign 0.30
R7267:Ttc37 UTSW 13 76180077 missense probably benign 0.15
X0067:Ttc37 UTSW 13 76132933 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TTGGTGGCAGATTCATAACAGAC -3'
(R):5'- CCCTCCAAGTAAACTAAAGGTGG -3'

Sequencing Primer
(F):5'- GGTGGCAGATTCATAACAGACTATTG -3'
(R):5'- CCAAGTAAACTAAAGGTGGTAGGAAG -3'
Posted On2017-02-15