Incidental Mutation 'R5888:Thsd7b'
ID457757
Institutional Source Beutler Lab
Gene Symbol Thsd7b
Ensembl Gene ENSMUSG00000042581
Gene Namethrombospondin, type I, domain containing 7B
Synonyms1700074E13Rik, D130067I03Rik
MMRRC Submission 044089-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.309) question?
Stock #R5888 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location129273302-130219278 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 130210320 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 1578 (Y1578*)
Ref Sequence ENSEMBL: ENSMUSP00000073220 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073527]
Predicted Effect probably null
Transcript: ENSMUST00000073527
AA Change: Y1578*
SMART Domains Protein: ENSMUSP00000073220
Gene: ENSMUSG00000042581
AA Change: Y1578*

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
Blast:TSP1 43 98 5e-29 BLAST
Blast:TSP1 122 177 9e-24 BLAST
TSP1 182 233 2.47e-9 SMART
TSP1 339 399 7e-9 SMART
Blast:TSP1 402 482 2e-27 BLAST
TSP1 487 543 2.12e-1 SMART
TSP1 604 661 3.9e-7 SMART
TSP1 664 735 2.73e-2 SMART
TSP1 740 796 1.01e-5 SMART
Blast:TSP1 799 869 6e-35 BLAST
TSP1 874 922 9.68e-3 SMART
TSP1 952 999 2.42e0 SMART
TSP1 1004 1059 3.96e-8 SMART
TSP1 1062 1126 1.73e0 SMART
TSP1 1131 1182 6.05e-4 SMART
TSP1 1185 1246 9.52e-1 SMART
TSP1 1251 1303 3.21e-8 SMART
TSP1 1304 1369 5.52e-1 SMART
TSP1 1374 1432 3.92e-2 SMART
transmembrane domain 1558 1580 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140834
Meta Mutation Damage Score 0.6548 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency 94% (96/102)
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029P11Rik T C 15: 81,980,671 S38P probably benign Het
Adcy1 T A 11: 7,139,095 V503E possibly damaging Het
Alk C A 17: 71,874,943 V1362L probably damaging Het
Ankrd55 T A 13: 112,355,919 I208N possibly damaging Het
Asap2 T A 12: 21,218,190 I319N probably damaging Het
Atp11b T C 3: 35,837,547 I1036T probably benign Het
B4gat1 T C 19: 5,039,532 F186L probably benign Het
C3 T A 17: 57,214,831 T1079S probably damaging Het
Cacul1 G T 19: 60,537,464 T287K possibly damaging Het
Cbr3 G C 16: 93,690,726 G266R probably damaging Het
Cd63 T A 10: 128,912,291 probably null Het
Chd7 G A 4: 8,866,382 M851I probably damaging Het
Chst13 T A 6: 90,309,572 H136L probably benign Het
Cyp2d22 T C 15: 82,373,813 T179A probably benign Het
Dclre1b A T 3: 103,803,737 V286E probably damaging Het
Defb45 G A 2: 152,593,234 probably benign Het
Dlg1 T C 16: 31,791,886 probably null Het
Dock3 A G 9: 107,023,803 V321A probably benign Het
Dytn A T 1: 63,677,237 V59E possibly damaging Het
Eif2ak1 A G 5: 143,886,915 I393M probably damaging Het
Fam83g A T 11: 61,702,594 E318V probably benign Het
Fbxo34 T A 14: 47,529,719 F179I probably damaging Het
Fmo5 T A 3: 97,641,725 Y230N probably benign Het
Fzd9 T G 5: 135,249,463 probably null Het
Gata2 T C 6: 88,200,740 S251P probably benign Het
Gigyf1 A G 5: 137,525,697 D1043G probably damaging Het
Gm10260 G A 13: 97,760,393 R66* probably null Het
Gm10322 T A 10: 59,616,303 S81T probably benign Het
Gm11639 T C 11: 104,721,401 probably benign Het
Gm15517 A T 7: 44,260,642 probably benign Het
Haus4 T C 14: 54,544,219 T232A probably benign Het
Hgfac A T 5: 35,045,407 H417L probably damaging Het
Iqgap2 T C 13: 95,635,610 K1354E possibly damaging Het
Kcnk12 C A 17: 87,746,649 R195L probably benign Het
Kcnn2 A T 18: 45,592,345 I303F probably damaging Het
Kcnt1 T C 2: 25,908,110 F879S probably damaging Het
Kndc1 T C 7: 139,895,217 F11L probably benign Het
Kpna7 A G 5: 144,989,795 F449S probably damaging Het
Krt77 G T 15: 101,865,453 N255K probably benign Het
Lair1 A T 7: 4,010,845 D134E probably damaging Het
Loxhd1 T C 18: 77,402,515 V1318A probably damaging Het
March10 A T 11: 105,402,146 V145D possibly damaging Het
Mcpt1 T A 14: 56,019,512 M169K probably benign Het
Mdc1 T A 17: 35,847,820 V364E probably benign Het
Mfsd11 T C 11: 116,871,384 F270S probably damaging Het
Mfsd4b2 T G 10: 39,922,035 D108A probably benign Het
Mink1 A T 11: 70,610,059 probably benign Het
Mmp25 T C 17: 23,631,074 Y504C probably damaging Het
Ms4a13 C T 19: 11,191,506 V52I probably benign Het
Msh4 C T 3: 153,867,723 probably null Het
Muc5b T G 7: 141,858,421 S1701R unknown Het
Naalad2 A T 9: 18,330,641 S656T probably benign Het
Ncapd2 T C 6: 125,187,089 Y64C probably damaging Het
Ncapg2 T A 12: 116,425,800 S347T possibly damaging Het
Nipal4 T C 11: 46,151,339 T172A probably damaging Het
Nrros T C 16: 32,143,087 K652R probably benign Het
Nrxn3 G T 12: 89,512,085 A983S possibly damaging Het
Olfr1084 A C 2: 86,639,144 L188R probably damaging Het
Olfr1187-ps1 T C 2: 88,540,244 noncoding transcript Het
Olfr1220 T A 2: 89,097,925 M1L probably damaging Het
Olfr1249 T A 2: 89,630,799 Y33F probably damaging Het
Olfr1283 T C 2: 111,368,743 M37T probably benign Het
Olfr631 A G 7: 103,929,032 T70A possibly damaging Het
Olfr938 A T 9: 39,077,967 Y259* probably null Het
P2rx4 T A 5: 122,719,165 S155T probably benign Het
P2rx4 T G 5: 122,727,208 Y299D probably damaging Het
Pcsk6 A T 7: 66,043,624 L7F probably null Het
Pdss2 T C 10: 43,221,797 silent Het
Pfkl A G 10: 77,991,370 V494A possibly damaging Het
Prep G T 10: 45,067,364 D12Y possibly damaging Het
Prg4 A G 1: 150,452,350 F188S probably damaging Het
Ripor3 T C 2: 167,997,287 Y98C probably damaging Het
Rnf216 T A 5: 143,068,314 probably null Het
Rnf24 A G 2: 131,322,245 probably benign Het
Scn3a A G 2: 65,497,398 M916T probably benign Het
Scnm1 T C 3: 95,130,285 I157V probably benign Het
Sh2b3 C G 5: 121,829,021 R10P possibly damaging Het
Slc25a27 T C 17: 43,649,694 D211G probably damaging Het
Slc36a4 A T 9: 15,727,028 Y250F probably damaging Het
Slc4a1 T A 11: 102,356,525 E448V probably damaging Het
Slit1 C A 19: 41,743,296 C38F probably damaging Het
Spock3 T A 8: 63,355,300 N410K unknown Het
Supt20 G T 3: 54,712,207 W370L probably benign Het
Tas2r139 T A 6: 42,141,496 N187K probably damaging Het
Tbc1d9b G A 11: 50,140,484 V111I probably benign Het
Tln2 T A 9: 67,229,403 I1267F probably damaging Het
Tnk2 G A 16: 32,671,367 V363I probably damaging Het
Ttc32 A G 12: 9,035,870 K139R possibly damaging Het
Vmn1r30 G C 6: 58,435,565 T94S possibly damaging Het
Vmn1r90 G A 7: 14,561,855 T106I probably damaging Het
Zfp677 T A 17: 21,398,258 C526S probably damaging Het
Zfp831 T G 2: 174,643,627 S32A probably benign Het
Other mutations in Thsd7b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Thsd7b APN 1 129595834 missense probably damaging 1.00
IGL00850:Thsd7b APN 1 130165077 missense probably benign 0.00
IGL00987:Thsd7b APN 1 129613279 missense probably damaging 1.00
IGL01068:Thsd7b APN 1 129596146 missense probably damaging 1.00
IGL01091:Thsd7b APN 1 129776334 missense probably benign 0.29
IGL01535:Thsd7b APN 1 129678217 missense possibly damaging 0.64
IGL01560:Thsd7b APN 1 130218181 utr 3 prime probably benign
IGL01701:Thsd7b APN 1 129430928 missense probably benign 0.07
IGL01775:Thsd7b APN 1 129628939 missense probably damaging 0.99
IGL02077:Thsd7b APN 1 129816682 missense probably damaging 1.00
IGL02338:Thsd7b APN 1 129595771 missense probably damaging 1.00
IGL02340:Thsd7b APN 1 130159632 missense probably benign 0.01
IGL02404:Thsd7b APN 1 129613151 missense probably damaging 1.00
IGL02519:Thsd7b APN 1 129613195 missense probably benign 0.22
IGL02543:Thsd7b APN 1 130165103 missense probably benign 0.03
IGL02740:Thsd7b APN 1 129613127 missense probably damaging 0.99
IGL02793:Thsd7b APN 1 129951393 missense probably damaging 1.00
IGL02875:Thsd7b APN 1 129951393 missense probably damaging 1.00
IGL02986:Thsd7b APN 1 129915615 missense probably benign 0.01
IGL03108:Thsd7b APN 1 130210276 missense probably damaging 1.00
IGL03114:Thsd7b APN 1 130188551 missense probably benign 0.00
IGL03195:Thsd7b APN 1 129628909 missense probably damaging 1.00
IGL03291:Thsd7b APN 1 129760355 missense possibly damaging 0.94
IGL03397:Thsd7b APN 1 129596164 missense probably benign 0.17
IGL03399:Thsd7b APN 1 129628885 missense probably damaging 1.00
R0184:Thsd7b UTSW 1 129430964 missense probably benign 0.00
R0277:Thsd7b UTSW 1 130195263 missense probably benign 0.00
R0526:Thsd7b UTSW 1 129951392 missense probably damaging 1.00
R0633:Thsd7b UTSW 1 130188526 missense possibly damaging 0.78
R0746:Thsd7b UTSW 1 130188531 missense probably benign 0.00
R0784:Thsd7b UTSW 1 129595359 splice site probably benign
R1158:Thsd7b UTSW 1 130189935 synonymous probably null
R1267:Thsd7b UTSW 1 129628840 intron probably null
R1375:Thsd7b UTSW 1 130159686 missense probably damaging 1.00
R1565:Thsd7b UTSW 1 129596041 missense possibly damaging 0.94
R1728:Thsd7b UTSW 1 129628891 missense probably damaging 1.00
R1728:Thsd7b UTSW 1 129667937 missense probably benign 0.00
R1728:Thsd7b UTSW 1 129678183 missense probably benign
R1728:Thsd7b UTSW 1 130116631 missense probably benign
R1729:Thsd7b UTSW 1 129628891 missense probably damaging 1.00
R1729:Thsd7b UTSW 1 129667937 missense probably benign 0.00
R1729:Thsd7b UTSW 1 129678183 missense probably benign
R1729:Thsd7b UTSW 1 130116631 missense probably benign
R1730:Thsd7b UTSW 1 129628891 missense probably damaging 1.00
R1730:Thsd7b UTSW 1 129667937 missense probably benign 0.00
R1730:Thsd7b UTSW 1 129678183 missense probably benign
R1730:Thsd7b UTSW 1 130116631 missense probably benign
R1739:Thsd7b UTSW 1 129628891 missense probably damaging 1.00
R1739:Thsd7b UTSW 1 129667937 missense probably benign 0.00
R1739:Thsd7b UTSW 1 129678183 missense probably benign
R1739:Thsd7b UTSW 1 130116631 missense probably benign
R1762:Thsd7b UTSW 1 129628891 missense probably damaging 1.00
R1762:Thsd7b UTSW 1 129667937 missense probably benign 0.00
R1762:Thsd7b UTSW 1 129678183 missense probably benign
R1762:Thsd7b UTSW 1 130103076 missense possibly damaging 0.92
R1762:Thsd7b UTSW 1 130116631 missense probably benign
R1783:Thsd7b UTSW 1 129628891 missense probably damaging 1.00
R1783:Thsd7b UTSW 1 129667937 missense probably benign 0.00
R1783:Thsd7b UTSW 1 129678183 missense probably benign
R1783:Thsd7b UTSW 1 130116631 missense probably benign
R1784:Thsd7b UTSW 1 129628891 missense probably damaging 1.00
R1784:Thsd7b UTSW 1 129667937 missense probably benign 0.00
R1784:Thsd7b UTSW 1 129678183 missense probably benign
R1784:Thsd7b UTSW 1 130116631 missense probably benign
R1785:Thsd7b UTSW 1 129628891 missense probably damaging 1.00
R1785:Thsd7b UTSW 1 129667937 missense probably benign 0.00
R1785:Thsd7b UTSW 1 129678183 missense probably benign
R1785:Thsd7b UTSW 1 130116631 missense probably benign
R1812:Thsd7b UTSW 1 129758610 missense probably damaging 1.00
R1846:Thsd7b UTSW 1 129613256 missense probably damaging 1.00
R1908:Thsd7b UTSW 1 129678109 missense probably damaging 0.99
R1996:Thsd7b UTSW 1 129758451 nonsense probably null
R2199:Thsd7b UTSW 1 130218158 missense probably benign 0.04
R2483:Thsd7b UTSW 1 130103072 missense probably damaging 1.00
R2919:Thsd7b UTSW 1 130189850 splice site probably benign
R2935:Thsd7b UTSW 1 129678087 missense possibly damaging 0.83
R3113:Thsd7b UTSW 1 130049862 missense probably benign 0.23
R3236:Thsd7b UTSW 1 130218118 nonsense probably null
R3745:Thsd7b UTSW 1 129678241 missense probably benign 0.04
R3877:Thsd7b UTSW 1 130190182 missense possibly damaging 0.92
R3880:Thsd7b UTSW 1 129595370 missense probably damaging 1.00
R4110:Thsd7b UTSW 1 130116619 missense probably benign 0.18
R4112:Thsd7b UTSW 1 130116619 missense probably benign 0.18
R4255:Thsd7b UTSW 1 129760287 missense possibly damaging 0.79
R4621:Thsd7b UTSW 1 129430915 missense possibly damaging 0.47
R4703:Thsd7b UTSW 1 130049909 intron probably benign
R4732:Thsd7b UTSW 1 129613186 missense probably damaging 1.00
R4733:Thsd7b UTSW 1 129613186 missense probably damaging 1.00
R4755:Thsd7b UTSW 1 130210264 missense probably benign 0.01
R4805:Thsd7b UTSW 1 130188539 missense probably benign 0.04
R4840:Thsd7b UTSW 1 129595844 missense probably benign 0.00
R4879:Thsd7b UTSW 1 130188499 missense possibly damaging 0.62
R4936:Thsd7b UTSW 1 129678145 missense probably benign 0.00
R4972:Thsd7b UTSW 1 130188572 missense probably damaging 0.97
R5304:Thsd7b UTSW 1 129678243 nonsense probably null
R5422:Thsd7b UTSW 1 129921334 missense probably benign 0.41
R5495:Thsd7b UTSW 1 129595833 missense probably damaging 1.00
R5598:Thsd7b UTSW 1 129595841 missense probably damaging 1.00
R5620:Thsd7b UTSW 1 130162936 critical splice donor site probably null
R5638:Thsd7b UTSW 1 129595533 missense probably benign 0.00
R5640:Thsd7b UTSW 1 130116671 nonsense probably null
R5655:Thsd7b UTSW 1 129628934 synonymous probably null
R5711:Thsd7b UTSW 1 129760402 missense probably damaging 1.00
R5823:Thsd7b UTSW 1 129678084 missense probably benign 0.00
R5932:Thsd7b UTSW 1 129430838 missense probably benign
R6243:Thsd7b UTSW 1 130162862 missense probably benign 0.21
R6258:Thsd7b UTSW 1 129667918 missense probably benign
R6260:Thsd7b UTSW 1 129667918 missense probably benign
R6399:Thsd7b UTSW 1 129816648 missense probably benign 0.13
R6437:Thsd7b UTSW 1 129816682 missense probably damaging 1.00
R6719:Thsd7b UTSW 1 130159714 splice site probably null
R6785:Thsd7b UTSW 1 129430907 missense probably damaging 0.99
X0027:Thsd7b UTSW 1 129596072 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGCTCTGGTTTGTCAAACATTAG -3'
(R):5'- GTGTTAACAGTATTGGCAAAGGTC -3'

Sequencing Primer
(F):5'- CTGGTTTGTCAAACATTAGGTTACTC -3'
(R):5'- GCAAAGGTCCTGCATTTCAACTG -3'
Posted On2017-02-15