Incidental Mutation 'R0559:Fbxl19'
ID45791
Institutional Source Beutler Lab
Gene Symbol Fbxl19
Ensembl Gene ENSMUSG00000030811
Gene NameF-box and leucine-rich repeat protein 19
SynonymsFbl19
MMRRC Submission 038751-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.912) question?
Stock #R0559 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location127744543-127769483 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 127750218 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Leucine at position 160 (W160L)
Ref Sequence ENSEMBL: ENSMUSP00000145616 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033081] [ENSMUST00000186116] [ENSMUST00000186207] [ENSMUST00000188580] [ENSMUST00000189562] [ENSMUST00000205689] [ENSMUST00000206893]
Predicted Effect possibly damaging
Transcript: ENSMUST00000033081
AA Change: W160L

PolyPhen 2 Score 0.506 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000033081
Gene: ENSMUSG00000030811
AA Change: W160L

DomainStartEndE-ValueType
Pfam:zf-CXXC 11 57 1.7e-16 PFAM
PHD 67 129 4e-4 SMART
low complexity region 166 183 N/A INTRINSIC
low complexity region 302 325 N/A INTRINSIC
low complexity region 355 377 N/A INTRINSIC
FBOX 404 444 4.6e-4 SMART
low complexity region 509 520 N/A INTRINSIC
LRR 576 601 3.58e1 SMART
LRR 631 656 1.28e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000186116
SMART Domains Protein: ENSMUSP00000140083
Gene: ENSMUSG00000030811

DomainStartEndE-ValueType
low complexity region 10 33 N/A INTRINSIC
low complexity region 63 85 N/A INTRINSIC
FBOX 112 152 3e-6 SMART
low complexity region 217 228 N/A INTRINSIC
LRR 284 309 1.5e-1 SMART
LRR 339 364 5.3e-6 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000186207
AA Change: W160L

PolyPhen 2 Score 0.506 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000140303
Gene: ENSMUSG00000030811
AA Change: W160L

DomainStartEndE-ValueType
Pfam:zf-CXXC 11 57 1.7e-16 PFAM
PHD 67 129 4e-4 SMART
low complexity region 166 183 N/A INTRINSIC
low complexity region 302 325 N/A INTRINSIC
low complexity region 355 377 N/A INTRINSIC
FBOX 404 444 4.6e-4 SMART
low complexity region 509 520 N/A INTRINSIC
LRR 576 601 3.58e1 SMART
LRR 631 656 1.28e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000188580
SMART Domains Protein: ENSMUSP00000140021
Gene: ENSMUSG00000030811

DomainStartEndE-ValueType
Pfam:zf-CXXC 11 57 1.3e-16 PFAM
PHD 67 129 4e-4 SMART
low complexity region 186 209 N/A INTRINSIC
low complexity region 239 261 N/A INTRINSIC
FBOX 288 328 4.6e-4 SMART
low complexity region 393 404 N/A INTRINSIC
LRR 460 485 3.58e1 SMART
LRR 515 540 1.28e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000189562
SMART Domains Protein: ENSMUSP00000139972
Gene: ENSMUSG00000030811

DomainStartEndE-ValueType
Pfam:zf-CXXC 11 57 9.3e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205689
Predicted Effect possibly damaging
Transcript: ENSMUST00000206893
AA Change: W160L

PolyPhen 2 Score 0.506 (Sensitivity: 0.88; Specificity: 0.90)
Meta Mutation Damage Score 0.106 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.5%
Validation Efficiency 97% (34/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Skp1-Cullin-F-box family of E3 ubiquitin ligases. The encoded protein is reported to bind to the transmembrane receptor interleukin 1 receptor-like 1 and regulate its ubiquitination and degradation. This protein has been linked to the regulation of pulmonary inflammation and psoriasis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a A T 5: 8,698,535 I289F probably benign Het
Adam15 G A 3: 89,343,778 A540V probably damaging Het
Adat1 T C 8: 111,982,430 T254A probably damaging Het
Agtpbp1 A G 13: 59,497,000 V684A probably benign Het
Ahi1 A G 10: 21,000,719 probably benign Het
Arl5b T C 2: 15,073,187 Y108H probably damaging Het
Cep85l A G 10: 53,348,501 F331L probably benign Het
Ctnna2 T C 6: 76,915,850 K785E probably damaging Het
Dgkd T A 1: 87,915,104 I118N probably damaging Het
Dicer1 G A 12: 104,706,301 R896W probably damaging Het
Gm21319 T A 12: 87,773,453 H112L probably benign Het
H1foo T C 6: 115,947,799 Y89H probably damaging Het
Ipo5 T C 14: 120,938,641 V626A probably damaging Het
Isx A G 8: 74,873,741 K34R probably benign Het
Myh6 T C 14: 54,958,554 E596G probably benign Het
Olfml2a T C 2: 38,959,820 I516T probably damaging Het
Olfr1135 T G 2: 87,671,900 T156P possibly damaging Het
Olfr126 C T 17: 37,850,855 R88* probably null Het
Olfr884 G T 9: 38,047,827 V202L probably benign Het
Parp9 T C 16: 35,947,992 F181L probably benign Het
Pkdcc G A 17: 83,216,025 G187D probably benign Het
Plekhh3 C T 11: 101,164,766 E483K possibly damaging Het
Ptx4 C T 17: 25,123,108 Q186* probably null Het
Qsox2 T A 2: 26,214,157 H287L probably benign Het
Rev3l G A 10: 39,824,487 G1660D probably damaging Het
Scamp1 G T 13: 94,208,182 A217E possibly damaging Het
Slc5a9 T C 4: 111,885,582 I438V probably benign Het
Sort1 T C 3: 108,356,579 F818S probably damaging Het
Srl G A 16: 4,496,978 P267S probably benign Het
Tbc1d1 T C 5: 64,173,793 I105T probably damaging Het
Tifab A G 13: 56,176,247 Y128H probably benign Het
Trp53bp1 A T 2: 121,227,801 S907T probably damaging Het
Ubr1 G A 2: 120,947,883 R225* probably null Het
Upk3bl A G 5: 136,057,476 T89A probably benign Het
Vars T A 17: 35,014,058 C916* probably null Het
Ywhaz T C 15: 36,790,964 E5G possibly damaging Het
Zfp91 T C 19: 12,770,055 D568G probably damaging Het
Zgpat T C 2: 181,380,192 probably benign Het
Other mutations in Fbxl19
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1933:Fbxl19 UTSW 7 127750929 missense probably benign
R2280:Fbxl19 UTSW 7 127748368 missense possibly damaging 0.80
R2935:Fbxl19 UTSW 7 127752260 missense probably damaging 0.97
R5580:Fbxl19 UTSW 7 127750996 nonsense probably null
R6032:Fbxl19 UTSW 7 127761265 missense probably damaging 1.00
R6032:Fbxl19 UTSW 7 127761265 missense probably damaging 1.00
R6054:Fbxl19 UTSW 7 127752509 missense probably damaging 0.99
R6540:Fbxl19 UTSW 7 127748353 utr 5 prime probably benign
R6825:Fbxl19 UTSW 7 127750015 missense probably damaging 0.99
R7136:Fbxl19 UTSW 7 127750045 missense possibly damaging 0.92
X0060:Fbxl19 UTSW 7 127767803 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- TGTACAATCTGCAACGAGATCGTCC -3'
(R):5'- TCCCATGTTCTAAGACAGCCGTCC -3'

Sequencing Primer
(F):5'- TCTCTTGCCTACAGATGGGAAAG -3'
(R):5'- TAAGACAGCCGTCCCCTTC -3'
Posted On2013-06-11