Incidental Mutation 'R5459:1520401A03Rik'
List |< first << previous [record 24 of 33389] next >> last >|
ID457914
Institutional Source Beutler Lab
Gene Symbol 1520401A03Rik
Ensembl Gene ENSMUSG00000043747
Gene NameRIKEN cDNA 1520401A03 gene
Synonyms
MMRRC Submission 043022-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.113) question?
Stock #R5459 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location23704488-23722783 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) C to T at 23711843 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000144664 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000178006] [ENSMUST00000201734]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000062827
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176095
Predicted Effect probably benign
Transcript: ENSMUST00000178006
SMART Domains Protein: ENSMUSP00000144253
Gene: ENSMUSG00000043747

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
low complexity region 18 47 N/A INTRINSIC
internal_repeat_1 49 75 7.63e-5 PROSPERO
low complexity region 82 99 N/A INTRINSIC
internal_repeat_1 101 132 7.63e-5 PROSPERO
low complexity region 133 164 N/A INTRINSIC
low complexity region 174 196 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201734
SMART Domains Protein: ENSMUSP00000144664
Gene: ENSMUSG00000043747

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 61 69 N/A INTRINSIC
low complexity region 72 85 N/A INTRINSIC
low complexity region 87 116 N/A INTRINSIC
internal_repeat_1 117 149 3.72e-8 PROSPERO
low complexity region 151 168 N/A INTRINSIC
low complexity region 202 233 N/A INTRINSIC
low complexity region 238 258 N/A INTRINSIC
internal_repeat_1 268 310 3.72e-8 PROSPERO
low complexity region 518 528 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300002M23Rik A G 17: 35,568,182 E139G possibly damaging Het
4931408C20Rik A C 1: 26,685,191 S303A probably damaging Het
Abcc6 T C 7: 45,982,183 N1223S probably benign Het
Adamts3 A T 5: 89,691,473 probably null Het
Aloxe3 T A 11: 69,132,828 F259Y possibly damaging Het
Armc9 G A 1: 86,207,972 R550Q probably damaging Het
Ctnnd2 A G 15: 30,887,188 D787G probably damaging Het
Dnah7b A G 1: 46,109,312 I283V probably null Het
Ebf2 A G 14: 67,235,201 M23V probably benign Het
Fbxw11 T C 11: 32,739,191 V438A possibly damaging Het
Fcrla G A 1: 170,918,169 T348M possibly damaging Het
Gpr179 A T 11: 97,336,657 H1557Q probably benign Het
Gpr87 A G 3: 59,179,727 V119A possibly damaging Het
Hfm1 A G 5: 106,904,763 S285P probably damaging Het
Hs3st5 T C 10: 36,828,746 V15A possibly damaging Het
Hyal5 C T 6: 24,891,251 H355Y probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Map4k3 T A 17: 80,609,787 N587Y probably damaging Het
Mcm3ap T A 10: 76,496,482 L1211* probably null Het
Mcmdc2 A G 1: 9,937,084 I620V probably benign Het
Micalcl C T 7: 112,382,237 H539Y probably benign Het
Myo9a T C 9: 59,884,520 L1802P probably damaging Het
Neto2 T A 8: 85,670,483 I47F probably benign Het
Olfr1443 A G 19: 12,680,435 E109G probably damaging Het
Oog3 G A 4: 144,159,245 T261I probably benign Het
Pdilt A G 7: 119,486,935 L519P probably benign Het
Pnpla6 A T 8: 3,535,829 M844L probably benign Het
Polk C T 13: 96,495,476 G250R probably damaging Het
Rasal2 A G 1: 157,157,661 S839P probably damaging Het
Siae T C 9: 37,616,823 Y31H probably damaging Het
Slc27a2 T C 2: 126,580,992 V379A probably damaging Het
Snx9 C T 17: 5,920,638 T418M probably damaging Het
Srp72 A G 5: 76,984,338 T258A probably benign Het
Tango6 T A 8: 106,850,289 D1058E probably damaging Het
Tecpr1 T A 5: 144,207,416 Y656F probably damaging Het
Tnik T A 3: 28,661,741 I1168K probably damaging Het
Togaram1 A G 12: 64,967,736 E587G probably damaging Het
Tyw1 A C 5: 130,274,706 D305A probably damaging Het
Vmn1r19 T A 6: 57,404,490 Y9* probably null Het
Zkscan3 A T 13: 21,394,812 V142E probably damaging Het
Other mutations in 1520401A03Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0332:1520401A03Rik UTSW 17 23714604 splice site probably benign
R1165:1520401A03Rik UTSW 17 23710515 splice site probably benign
R1539:1520401A03Rik UTSW 17 23717144 splice site probably benign
R2968:1520401A03Rik UTSW 17 23715811 missense possibly damaging 0.90
R5800:1520401A03Rik UTSW 17 23717992 missense probably damaging 0.96
R5967:1520401A03Rik UTSW 17 23712358 missense probably damaging 1.00
R6246:1520401A03Rik UTSW 17 23710491 nonsense probably null
R6306:1520401A03Rik UTSW 17 23706150 missense possibly damaging 0.66
R6892:1520401A03Rik UTSW 17 23712354 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TCTCATCAGACTGGACTCCC -3'
(R):5'- TCCAAAGCCAGGTGAGGTCTAC -3'

Sequencing Primer
(F):5'- CAGTTCCATTCCTAAACCCCGG -3'
(R):5'- CAGGTGAGGTCTACCCTGTG -3'
Posted On2017-02-16