Incidental Mutation 'R5611:Nop58'
ID457993
Institutional Source Beutler Lab
Gene Symbol Nop58
Ensembl Gene ENSMUSG00000026020
Gene NameNOP58 ribonucleoprotein
SynonymsMSSP, SIK similar protein, Nol5
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.972) question?
Stock #R5611 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location59684971-59719044 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to A at 59710513 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000141100 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027174] [ENSMUST00000190265] [ENSMUST00000191142]
Predicted Effect probably benign
Transcript: ENSMUST00000027174
SMART Domains Protein: ENSMUSP00000027174
Gene: ENSMUSG00000026020

DomainStartEndE-ValueType
Pfam:NOP5NT 2 66 1.1e-25 PFAM
low complexity region 67 81 N/A INTRINSIC
NOSIC 161 213 2.68e-29 SMART
low complexity region 218 239 N/A INTRINSIC
coiled coil region 441 491 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000187491
Predicted Effect unknown
Transcript: ENSMUST00000187837
AA Change: M163K
Predicted Effect probably benign
Transcript: ENSMUST00000188390
Predicted Effect probably benign
Transcript: ENSMUST00000190265
SMART Domains Protein: ENSMUSP00000141100
Gene: ENSMUSG00000026020

DomainStartEndE-ValueType
NOSIC 31 83 2.1e-33 SMART
low complexity region 88 109 N/A INTRINSIC
Pfam:Nop 123 179 5.8e-17 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000191142
AA Change: M474K
SMART Domains Protein: ENSMUSP00000140250
Gene: ENSMUSG00000026020
AA Change: M474K

DomainStartEndE-ValueType
Pfam:NOP5NT 1 66 3.2e-26 PFAM
low complexity region 67 81 N/A INTRINSIC
NOSIC 161 213 2.68e-29 SMART
low complexity region 218 239 N/A INTRINSIC
Pfam:Nop 253 401 2.7e-63 PFAM
coiled coil region 441 491 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a core component of box C/D small nucleolar ribonucleoproteins. Some box C/D small nucleolar RNAs (snoRNAs), such as U3, U8, and U14, are dependent upon the encoded protein for their synthesis. This protein is SUMOylated, which is necessary for high affinity binding to snoRNAs. [provided by RefSeq, Nov 2015]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik2 G C 11: 49,020,001 T535R possibly damaging Het
Adam34 A T 8: 43,651,712 F299I probably benign Het
Adamts20 A G 15: 94,273,280 M1854T possibly damaging Het
Apbb1 A G 7: 105,559,483 V581A probably damaging Het
Apol6 T A 15: 77,051,040 probably null Het
Arhgef37 T C 18: 61,507,263 T242A probably benign Het
Asxl2 T C 12: 3,484,598 V265A probably damaging Het
Bicd1 A T 6: 149,513,456 R556* probably null Het
C2 A G 17: 34,872,384 I101T probably damaging Het
Cd22 T A 7: 30,878,150 probably benign Het
Cd33 T C 7: 43,532,118 H206R probably damaging Het
Cd5l G A 3: 87,367,775 G207D possibly damaging Het
Chrd A T 16: 20,738,974 D774V probably damaging Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Csn1s1 A T 5: 87,677,644 probably null Het
Dpyd G A 3: 119,194,293 V704I probably benign Het
Dscc1 C A 15: 55,082,173 Q312H probably benign Het
Dysf A T 6: 84,064,878 T154S probably damaging Het
Foxi2 T C 7: 135,411,704 V221A probably benign Het
Gabbr2 A T 4: 46,804,105 I250N probably damaging Het
Gfap T A 11: 102,897,069 T17S probably benign Het
Gm9774 G A 3: 92,428,451 P315S probably damaging Het
Hcrtr2 A G 9: 76,323,314 V64A probably damaging Het
Igkv4-86 A G 6: 68,910,675 S27P probably damaging Het
Kalrn G T 16: 34,175,780 F903L probably damaging Het
Lrrc31 A G 3: 30,691,155 probably null Het
Mlh3 T C 12: 85,267,445 T656A probably benign Het
Mss51 G T 14: 20,483,106 S432R possibly damaging Het
Mzf1 A G 7: 13,044,627 probably benign Het
Olfr121 A T 17: 37,752,084 I77F possibly damaging Het
Otogl T C 10: 107,786,769 E1652G probably damaging Het
Pikfyve C A 1: 65,256,088 N1459K probably damaging Het
Pkn3 G A 2: 30,079,661 G61D probably damaging Het
Plekha4 T C 7: 45,553,641 S581P probably benign Het
Ppm1g A G 5: 31,206,097 F256L probably damaging Het
Proser1 A G 3: 53,478,875 N726S probably benign Het
Rapgef1 A G 2: 29,702,436 D480G probably damaging Het
Reln G A 5: 22,039,665 Q772* probably null Het
Sh3gl2 T C 4: 85,355,331 V40A probably benign Het
Slc22a23 G A 13: 34,305,239 T221I probably benign Het
Slc22a28 T A 19: 8,063,333 T518S probably damaging Het
Slc4a1ap A G 5: 31,553,829 probably benign Het
St8sia4 T C 1: 95,627,684 D207G probably damaging Het
Syde1 T A 10: 78,585,891 T609S probably benign Het
Tbc1d5 A G 17: 50,735,967 I831T probably damaging Het
Tle4 T C 19: 14,449,795 D754G probably damaging Het
Ttn C T 2: 76,732,525 W26949* probably null Het
Vmn1r222 A C 13: 23,232,573 S157A probably damaging Het
Vmn1r51 T A 6: 90,129,710 L203M probably benign Het
Vmn1r6 T C 6: 57,002,377 L8P probably damaging Het
Vmn2r103 A G 17: 19,793,642 D232G probably damaging Het
Vmn2r17 T A 5: 109,428,164 D300E probably damaging Het
Vmn2r66 T A 7: 85,005,743 K453* probably null Het
Vps13a A T 19: 16,725,572 D672E probably damaging Het
Vps54 A G 11: 21,311,130 N599S possibly damaging Het
Zc3h13 A T 14: 75,330,908 N1214Y probably benign Het
Zc3h18 T G 8: 122,408,370 probably null Het
Zfp51 A G 17: 21,464,092 E323G probably damaging Het
Other mutations in Nop58
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01994:Nop58 APN 1 59704083 missense probably damaging 0.98
R0584:Nop58 UTSW 1 59706760 missense probably benign 0.00
R1170:Nop58 UTSW 1 59704211 splice site probably benign
R1177:Nop58 UTSW 1 59700932 missense probably damaging 1.00
R1485:Nop58 UTSW 1 59698345 missense probably damaging 0.98
R1588:Nop58 UTSW 1 59702872 missense probably damaging 1.00
R4715:Nop58 UTSW 1 59696026 missense probably benign 0.00
R5933:Nop58 UTSW 1 59704665 nonsense probably null
R5979:Nop58 UTSW 1 59702831 missense probably damaging 1.00
R6010:Nop58 UTSW 1 59700912 missense probably damaging 1.00
R6244:Nop58 UTSW 1 59702855 missense probably damaging 1.00
R6371:Nop58 UTSW 1 59711312 unclassified probably benign
Predicted Primers
Posted On2017-02-16