Incidental Mutation 'R5611:Slc22a28'
ID457997
Institutional Source Beutler Lab
Gene Symbol Slc22a28
Ensembl Gene ENSMUSG00000063590
Gene Namesolute carrier family 22, member 28
SynonymsGm5631
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.206) question?
Stock #R5611 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location8062209-8131982 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 8063333 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 518 (T518S)
Ref Sequence ENSEMBL: ENSMUSP00000067114 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065651]
Predicted Effect probably damaging
Transcript: ENSMUST00000065651
AA Change: T518S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000067114
Gene: ENSMUSG00000063590
AA Change: T518S

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Sugar_tr 99 527 1.4e-26 PFAM
Pfam:MFS_1 140 375 1.1e-15 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik2 G C 11: 49,020,001 T535R possibly damaging Het
Adam34 A T 8: 43,651,712 F299I probably benign Het
Adamts20 A G 15: 94,273,280 M1854T possibly damaging Het
Apbb1 A G 7: 105,559,483 V581A probably damaging Het
Apol6 T A 15: 77,051,040 probably null Het
Arhgef37 T C 18: 61,507,263 T242A probably benign Het
Asxl2 T C 12: 3,484,598 V265A probably damaging Het
Bicd1 A T 6: 149,513,456 R556* probably null Het
C2 A G 17: 34,872,384 I101T probably damaging Het
Cd22 T A 7: 30,878,150 probably benign Het
Cd33 T C 7: 43,532,118 H206R probably damaging Het
Cd5l G A 3: 87,367,775 G207D possibly damaging Het
Chrd A T 16: 20,738,974 D774V probably damaging Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Csn1s1 A T 5: 87,677,644 probably null Het
Dpyd G A 3: 119,194,293 V704I probably benign Het
Dscc1 C A 15: 55,082,173 Q312H probably benign Het
Dysf A T 6: 84,064,878 T154S probably damaging Het
Foxi2 T C 7: 135,411,704 V221A probably benign Het
Gabbr2 A T 4: 46,804,105 I250N probably damaging Het
Gfap T A 11: 102,897,069 T17S probably benign Het
Gm9774 G A 3: 92,428,451 P315S probably damaging Het
Hcrtr2 A G 9: 76,323,314 V64A probably damaging Het
Igkv4-86 A G 6: 68,910,675 S27P probably damaging Het
Kalrn G T 16: 34,175,780 F903L probably damaging Het
Lrrc31 A G 3: 30,691,155 probably null Het
Mlh3 T C 12: 85,267,445 T656A probably benign Het
Mss51 G T 14: 20,483,106 S432R possibly damaging Het
Mzf1 A G 7: 13,044,627 probably benign Het
Nop58 T A 1: 59,710,513 probably benign Het
Olfr121 A T 17: 37,752,084 I77F possibly damaging Het
Otogl T C 10: 107,786,769 E1652G probably damaging Het
Pikfyve C A 1: 65,256,088 N1459K probably damaging Het
Pkn3 G A 2: 30,079,661 G61D probably damaging Het
Plekha4 T C 7: 45,553,641 S581P probably benign Het
Ppm1g A G 5: 31,206,097 F256L probably damaging Het
Proser1 A G 3: 53,478,875 N726S probably benign Het
Rapgef1 A G 2: 29,702,436 D480G probably damaging Het
Reln G A 5: 22,039,665 Q772* probably null Het
Sh3gl2 T C 4: 85,355,331 V40A probably benign Het
Slc22a23 G A 13: 34,305,239 T221I probably benign Het
Slc4a1ap A G 5: 31,553,829 probably benign Het
St8sia4 T C 1: 95,627,684 D207G probably damaging Het
Syde1 T A 10: 78,585,891 T609S probably benign Het
Tbc1d5 A G 17: 50,735,967 I831T probably damaging Het
Tle4 T C 19: 14,449,795 D754G probably damaging Het
Ttn C T 2: 76,732,525 W26949* probably null Het
Vmn1r222 A C 13: 23,232,573 S157A probably damaging Het
Vmn1r51 T A 6: 90,129,710 L203M probably benign Het
Vmn1r6 T C 6: 57,002,377 L8P probably damaging Het
Vmn2r103 A G 17: 19,793,642 D232G probably damaging Het
Vmn2r17 T A 5: 109,428,164 D300E probably damaging Het
Vmn2r66 T A 7: 85,005,743 K453* probably null Het
Vps13a A T 19: 16,725,572 D672E probably damaging Het
Vps54 A G 11: 21,311,130 N599S possibly damaging Het
Zc3h13 A T 14: 75,330,908 N1214Y probably benign Het
Zc3h18 T G 8: 122,408,370 probably null Het
Zfp51 A G 17: 21,464,092 E323G probably damaging Het
Other mutations in Slc22a28
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Slc22a28 APN 19 8130203 missense possibly damaging 0.89
IGL00515:Slc22a28 APN 19 8117064 missense probably benign 0.34
IGL01025:Slc22a28 APN 19 8116908 splice site probably benign
IGL02697:Slc22a28 APN 19 8117127 missense probably benign 0.06
R0744:Slc22a28 UTSW 19 8116833 missense possibly damaging 0.94
R0836:Slc22a28 UTSW 19 8116833 missense possibly damaging 0.94
R1398:Slc22a28 UTSW 19 8130202 nonsense probably null
R1456:Slc22a28 UTSW 19 8071858 missense possibly damaging 0.50
R1603:Slc22a28 UTSW 19 8063309 missense probably damaging 1.00
R1993:Slc22a28 UTSW 19 8117124 missense possibly damaging 0.79
R2254:Slc22a28 UTSW 19 8064493 missense probably benign
R2262:Slc22a28 UTSW 19 8071208 missense probably benign 0.00
R4078:Slc22a28 UTSW 19 8101413 missense probably benign 0.15
R4165:Slc22a28 UTSW 19 8063408 missense possibly damaging 0.95
R4612:Slc22a28 UTSW 19 8101406 missense probably damaging 1.00
R4947:Slc22a28 UTSW 19 8131452 missense probably benign 0.03
R5573:Slc22a28 UTSW 19 8071097 missense possibly damaging 0.50
R5621:Slc22a28 UTSW 19 8071011 missense probably benign 0.00
R5671:Slc22a28 UTSW 19 8131431 missense probably damaging 1.00
R6063:Slc22a28 UTSW 19 8117022 missense probably benign 0.01
R6358:Slc22a28 UTSW 19 8071888 missense probably damaging 0.99
R6385:Slc22a28 UTSW 19 8101480 missense probably damaging 0.99
R6680:Slc22a28 UTSW 19 8101393 missense probably benign 0.07
R6767:Slc22a28 UTSW 19 8117045 missense probably damaging 1.00
R6865:Slc22a28 UTSW 19 8064491 nonsense probably null
R6947:Slc22a28 UTSW 19 8064510 missense possibly damaging 0.58
Z1088:Slc22a28 UTSW 19 8062398 missense probably damaging 0.96
Predicted Primers
Posted On2017-02-16