Incidental Mutation 'R0559:Agtpbp1'
ID45802
Institutional Source Beutler Lab
Gene Symbol Agtpbp1
Ensembl Gene ENSMUSG00000021557
Gene NameATP/GTP binding protein 1
Synonyms2310001G17Rik, Nna1, 1700020N17Rik, 4930445M19Rik, 2900054O13Rik, 5730402G09Rik
MMRRC Submission 038751-MU
Accession Numbers

Genbank: NM_023328; MGI: 2159437

Is this an essential gene? Probably essential (E-score: 0.761) question?
Stock #R0559 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location59445742-59585227 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 59497000 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 684 (V684A)
Ref Sequence ENSEMBL: ENSMUSP00000132697 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022040] [ENSMUST00000109830] [ENSMUST00000164215] [ENSMUST00000165477] [ENSMUST00000169745] [ENSMUST00000170555] [ENSMUST00000171606]
Predicted Effect probably benign
Transcript: ENSMUST00000022040
AA Change: V684A

PolyPhen 2 Score 0.320 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000022040
Gene: ENSMUSG00000021557
AA Change: V684A

DomainStartEndE-ValueType
low complexity region 362 391 N/A INTRINSIC
low complexity region 589 603 N/A INTRINSIC
Pfam:Peptidase_M14 851 1099 1.7e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109830
AA Change: V684A

PolyPhen 2 Score 0.320 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000105456
Gene: ENSMUSG00000021557
AA Change: V684A

DomainStartEndE-ValueType
Pfam:V-ATPase_H_N 34 309 2.3e-7 PFAM
low complexity region 362 391 N/A INTRINSIC
low complexity region 589 603 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000163149
AA Change: V571A
SMART Domains Protein: ENSMUSP00000126238
Gene: ENSMUSG00000021557
AA Change: V571A

DomainStartEndE-ValueType
low complexity region 250 279 N/A INTRINSIC
low complexity region 477 491 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164215
AA Change: V684A

PolyPhen 2 Score 0.320 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000130939
Gene: ENSMUSG00000021557
AA Change: V684A

DomainStartEndE-ValueType
low complexity region 362 391 N/A INTRINSIC
low complexity region 589 603 N/A INTRINSIC
Pfam:Peptidase_M14 847 1123 1.2e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165477
Predicted Effect probably benign
Transcript: ENSMUST00000169745
Predicted Effect probably benign
Transcript: ENSMUST00000170555
AA Change: V684A

PolyPhen 2 Score 0.320 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000128589
Gene: ENSMUSG00000021557
AA Change: V684A

DomainStartEndE-ValueType
Pfam:V-ATPase_H_N 34 309 2.4e-7 PFAM
low complexity region 362 391 N/A INTRINSIC
low complexity region 589 603 N/A INTRINSIC
low complexity region 787 795 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171606
AA Change: V684A

PolyPhen 2 Score 0.320 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000132697
Gene: ENSMUSG00000021557
AA Change: V684A

DomainStartEndE-ValueType
Pfam:V-ATPase_H_N 34 309 2.3e-7 PFAM
low complexity region 362 391 N/A INTRINSIC
low complexity region 589 603 N/A INTRINSIC
Meta Mutation Damage Score 0.306 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.5%
Validation Efficiency 97% (34/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] NNA1 is a zinc carboxypeptidase that contains nuclear localization signals and an ATP/GTP-binding motif that was initially cloned from regenerating spinal cord neurons of the mouse.[supplied by OMIM, Jul 2002]
PHENOTYPE: Homozygotes show moderate ataxia due to degeneration of Purkinje cells of the cerebellum. Also, there is gradual degeneration of retina photoreceptor cells, olfactory bulb mitral cells and some thalamic neurons. Males have abnormal sperm and are sterile. [provided by MGI curators]
Allele List at MGI

All alleles(17) : Gene trapped(6) Transgenic(1) Spontaneous(6) Chemically induced(4)

Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a A T 5: 8,698,535 I289F probably benign Het
Adam15 G A 3: 89,343,778 A540V probably damaging Het
Adat1 T C 8: 111,982,430 T254A probably damaging Het
Ahi1 A G 10: 21,000,719 probably benign Het
Arl5b T C 2: 15,073,187 Y108H probably damaging Het
Cep85l A G 10: 53,348,501 F331L probably benign Het
Ctnna2 T C 6: 76,915,850 K785E probably damaging Het
Dgkd T A 1: 87,915,104 I118N probably damaging Het
Dicer1 G A 12: 104,706,301 R896W probably damaging Het
Fbxl19 G T 7: 127,750,218 W160L possibly damaging Het
Gm21319 T A 12: 87,773,453 H112L probably benign Het
H1foo T C 6: 115,947,799 Y89H probably damaging Het
Ipo5 T C 14: 120,938,641 V626A probably damaging Het
Isx A G 8: 74,873,741 K34R probably benign Het
Myh6 T C 14: 54,958,554 E596G probably benign Het
Olfml2a T C 2: 38,959,820 I516T probably damaging Het
Olfr1135 T G 2: 87,671,900 T156P possibly damaging Het
Olfr126 C T 17: 37,850,855 R88* probably null Het
Olfr884 G T 9: 38,047,827 V202L probably benign Het
Parp9 T C 16: 35,947,992 F181L probably benign Het
Pkdcc G A 17: 83,216,025 G187D probably benign Het
Plekhh3 C T 11: 101,164,766 E483K possibly damaging Het
Ptx4 C T 17: 25,123,108 Q186* probably null Het
Qsox2 T A 2: 26,214,157 H287L probably benign Het
Rev3l G A 10: 39,824,487 G1660D probably damaging Het
Scamp1 G T 13: 94,208,182 A217E possibly damaging Het
Slc5a9 T C 4: 111,885,582 I438V probably benign Het
Sort1 T C 3: 108,356,579 F818S probably damaging Het
Srl G A 16: 4,496,978 P267S probably benign Het
Tbc1d1 T C 5: 64,173,793 I105T probably damaging Het
Tifab A G 13: 56,176,247 Y128H probably benign Het
Trp53bp1 A T 2: 121,227,801 S907T probably damaging Het
Ubr1 G A 2: 120,947,883 R225* probably null Het
Upk3bl A G 5: 136,057,476 T89A probably benign Het
Vars T A 17: 35,014,058 C916* probably null Het
Ywhaz T C 15: 36,790,964 E5G possibly damaging Het
Zfp91 T C 19: 12,770,055 D568G probably damaging Het
Zgpat T C 2: 181,380,192 probably benign Het
Other mutations in Agtpbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00544:Agtpbp1 APN 13 59450172 missense probably damaging 1.00
IGL00808:Agtpbp1 APN 13 59462094 missense possibly damaging 0.84
IGL01298:Agtpbp1 APN 13 59504226 missense possibly damaging 0.77
IGL01628:Agtpbp1 APN 13 59508063 splice site probably benign
IGL01921:Agtpbp1 APN 13 59512483 missense possibly damaging 0.71
IGL02189:Agtpbp1 APN 13 59500461 missense probably benign 0.01
IGL02325:Agtpbp1 APN 13 59500489 missense probably benign 0.01
IGL02700:Agtpbp1 APN 13 59528419 missense probably damaging 1.00
IGL02821:Agtpbp1 APN 13 59482601 missense possibly damaging 0.69
IGL03130:Agtpbp1 APN 13 59474589 missense possibly damaging 0.73
IGL03167:Agtpbp1 APN 13 59532080 splice site probably benign
IGL03218:Agtpbp1 APN 13 59500207 missense possibly damaging 0.94
drunk UTSW 13 59512323 critical splice donor site probably benign
gru UTSW 13 59473746 missense probably damaging 1.00
rio UTSW 13 59525241 critical splice acceptor site probably benign
wobble UTSW 13 59474550 missense probably damaging 1.00
R0025:Agtpbp1 UTSW 13 59500200 missense probably benign 0.00
R0025:Agtpbp1 UTSW 13 59500200 missense probably benign 0.00
R0276:Agtpbp1 UTSW 13 59462031 missense possibly damaging 0.93
R0413:Agtpbp1 UTSW 13 59514152 missense probably benign 0.24
R0848:Agtpbp1 UTSW 13 59533939 intron probably benign
R0943:Agtpbp1 UTSW 13 59500602 missense probably benign
R1196:Agtpbp1 UTSW 13 59450318 unclassified probably benign
R1421:Agtpbp1 UTSW 13 59495575 missense possibly damaging 0.86
R1531:Agtpbp1 UTSW 13 59500634 synonymous probably null
R1833:Agtpbp1 UTSW 13 59465983 critical splice donor site probably null
R1864:Agtpbp1 UTSW 13 59450202 missense possibly damaging 0.92
R1994:Agtpbp1 UTSW 13 59531058 missense probably damaging 1.00
R1995:Agtpbp1 UTSW 13 59531058 missense probably damaging 1.00
R2001:Agtpbp1 UTSW 13 59475803 frame shift probably null
R2006:Agtpbp1 UTSW 13 59500321 missense probably benign 0.00
R2397:Agtpbp1 UTSW 13 59474569 missense probably benign 0.10
R2918:Agtpbp1 UTSW 13 59497015 missense possibly damaging 0.90
R3873:Agtpbp1 UTSW 13 59460596 missense possibly damaging 0.88
R3924:Agtpbp1 UTSW 13 59500407 missense probably benign 0.01
R4649:Agtpbp1 UTSW 13 59528399 missense possibly damaging 0.89
R4913:Agtpbp1 UTSW 13 59500072 missense probably damaging 1.00
R4933:Agtpbp1 UTSW 13 59500572 missense probably benign
R4969:Agtpbp1 UTSW 13 59500578 missense probably benign
R5066:Agtpbp1 UTSW 13 59474550 missense probably damaging 1.00
R5139:Agtpbp1 UTSW 13 59500213 missense probably damaging 0.99
R5194:Agtpbp1 UTSW 13 59500639 missense probably benign 0.19
R5269:Agtpbp1 UTSW 13 59473743 missense probably damaging 1.00
R5352:Agtpbp1 UTSW 13 59473746 missense probably damaging 1.00
R5558:Agtpbp1 UTSW 13 59482580 missense probably benign 0.05
R5687:Agtpbp1 UTSW 13 59500515 missense probably benign
R5824:Agtpbp1 UTSW 13 59466099 missense probably damaging 1.00
R5979:Agtpbp1 UTSW 13 59534046 nonsense probably null
R6109:Agtpbp1 UTSW 13 59473746 missense probably damaging 1.00
R6264:Agtpbp1 UTSW 13 59450300 missense possibly damaging 0.89
R6413:Agtpbp1 UTSW 13 59500020 missense possibly damaging 0.90
R6498:Agtpbp1 UTSW 13 59477040 missense possibly damaging 0.71
R6747:Agtpbp1 UTSW 13 59544353 intron probably null
R6950:Agtpbp1 UTSW 13 59450266 missense probably benign 0.32
R7030:Agtpbp1 UTSW 13 59504294 missense probably damaging 1.00
R7180:Agtpbp1 UTSW 13 59466038 missense probably benign 0.11
R7196:Agtpbp1 UTSW 13 59533180 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- AGCCTTCCTTGTGAACCCACAC -3'
(R):5'- TGATGGCACTTTCCATGCCAGAC -3'

Sequencing Primer
(F):5'- GTGCCAGATCATAATCTCTACATTC -3'
(R):5'- TGCCAGACTTAAACCTGGGAG -3'
Posted On2013-06-11