Incidental Mutation 'R0559:Pkdcc'
ID45812
Institutional Source Beutler Lab
Gene Symbol Pkdcc
Ensembl Gene ENSMUSG00000024247
Gene Nameprotein kinase domain containing, cytoplasmic
SynonymsMAd1, Vlk, Adtk1, ESTM17
MMRRC Submission 038751-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0559 (G1)
Quality Score105
Status Validated
Chromosome17
Chromosomal Location83215292-83225070 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 83216025 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 187 (G187D)
Ref Sequence ENSEMBL: ENSMUSP00000129238 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170794]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166528
Predicted Effect probably benign
Transcript: ENSMUST00000170758
Predicted Effect probably benign
Transcript: ENSMUST00000170794
AA Change: G187D

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000129238
Gene: ENSMUSG00000024247
AA Change: G187D

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 28 55 N/A INTRINSIC
low complexity region 72 86 N/A INTRINSIC
low complexity region 92 128 N/A INTRINSIC
Pfam:Pkinase 139 321 1.3e-5 PFAM
Pfam:PIP49_C 196 373 3.8e-11 PFAM
Meta Mutation Damage Score 0.13 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.5%
Validation Efficiency 97% (34/35)
MGI Phenotype PHENOTYPE: Homozygous null mutants die on postnatal day P0, apparently due to ineffective respiration. They exhibit shortening of all the long bones of the fore- and hindlimbs, cleft palate, sternal dysraphia and deficient mineralization or other anomalies of multiple bones throughout the body. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a A T 5: 8,698,535 I289F probably benign Het
Adam15 G A 3: 89,343,778 A540V probably damaging Het
Adat1 T C 8: 111,982,430 T254A probably damaging Het
Agtpbp1 A G 13: 59,497,000 V684A probably benign Het
Ahi1 A G 10: 21,000,719 probably benign Het
Arl5b T C 2: 15,073,187 Y108H probably damaging Het
Cep85l A G 10: 53,348,501 F331L probably benign Het
Ctnna2 T C 6: 76,915,850 K785E probably damaging Het
Dgkd T A 1: 87,915,104 I118N probably damaging Het
Dicer1 G A 12: 104,706,301 R896W probably damaging Het
Fbxl19 G T 7: 127,750,218 W160L possibly damaging Het
Gm21319 T A 12: 87,773,453 H112L probably benign Het
H1foo T C 6: 115,947,799 Y89H probably damaging Het
Ipo5 T C 14: 120,938,641 V626A probably damaging Het
Isx A G 8: 74,873,741 K34R probably benign Het
Myh6 T C 14: 54,958,554 E596G probably benign Het
Olfml2a T C 2: 38,959,820 I516T probably damaging Het
Olfr1135 T G 2: 87,671,900 T156P possibly damaging Het
Olfr126 C T 17: 37,850,855 R88* probably null Het
Olfr884 G T 9: 38,047,827 V202L probably benign Het
Parp9 T C 16: 35,947,992 F181L probably benign Het
Plekhh3 C T 11: 101,164,766 E483K possibly damaging Het
Ptx4 C T 17: 25,123,108 Q186* probably null Het
Qsox2 T A 2: 26,214,157 H287L probably benign Het
Rev3l G A 10: 39,824,487 G1660D probably damaging Het
Scamp1 G T 13: 94,208,182 A217E possibly damaging Het
Slc5a9 T C 4: 111,885,582 I438V probably benign Het
Sort1 T C 3: 108,356,579 F818S probably damaging Het
Srl G A 16: 4,496,978 P267S probably benign Het
Tbc1d1 T C 5: 64,173,793 I105T probably damaging Het
Tifab A G 13: 56,176,247 Y128H probably benign Het
Trp53bp1 A T 2: 121,227,801 S907T probably damaging Het
Ubr1 G A 2: 120,947,883 R225* probably null Het
Upk3bl A G 5: 136,057,476 T89A probably benign Het
Vars T A 17: 35,014,058 C916* probably null Het
Ywhaz T C 15: 36,790,964 E5G possibly damaging Het
Zfp91 T C 19: 12,770,055 D568G probably damaging Het
Zgpat T C 2: 181,380,192 probably benign Het
Other mutations in Pkdcc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01897:Pkdcc APN 17 83220119 missense probably damaging 1.00
IGL02517:Pkdcc APN 17 83223866 missense probably damaging 1.00
PIT4791001:Pkdcc UTSW 17 83220148 nonsense probably null
R0180:Pkdcc UTSW 17 83221870 critical splice donor site probably null
R0321:Pkdcc UTSW 17 83222112 splice site probably benign
R0799:Pkdcc UTSW 17 83223918 missense probably damaging 1.00
R1512:Pkdcc UTSW 17 83220044 missense possibly damaging 0.88
R2484:Pkdcc UTSW 17 83222238 splice site probably benign
R2916:Pkdcc UTSW 17 83215949 missense probably benign 0.00
R2918:Pkdcc UTSW 17 83215949 missense probably benign 0.00
R3120:Pkdcc UTSW 17 83220037 missense probably damaging 1.00
R3794:Pkdcc UTSW 17 83223953 missense probably damaging 0.97
R3795:Pkdcc UTSW 17 83223953 missense probably damaging 0.97
R4433:Pkdcc UTSW 17 83221141 missense probably benign 0.02
R4689:Pkdcc UTSW 17 83215861 missense probably damaging 1.00
R5239:Pkdcc UTSW 17 83215984 missense probably damaging 1.00
R5580:Pkdcc UTSW 17 83220082 missense probably damaging 0.96
R5654:Pkdcc UTSW 17 83215908 missense probably damaging 1.00
R5739:Pkdcc UTSW 17 83215794 missense probably benign 0.44
R6456:Pkdcc UTSW 17 83220119 missense probably damaging 1.00
R7046:Pkdcc UTSW 17 83224258 missense probably damaging 0.97
R7050:Pkdcc UTSW 17 83215644 missense possibly damaging 0.46
Z1088:Pkdcc UTSW 17 83222150 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCAACGTGCTCTTCGCACCG -3'
(R):5'- ACTCCGTAAGACCAAGGAGTCTTTCA -3'

Sequencing Primer
(F):5'- CCTGATGGACCTGGCTcc -3'
(R):5'- ACCAAGGAGTCTTTCAGAGTG -3'
Posted On2013-06-11