Incidental Mutation 'R5173:Cenpp'
ID458189
Institutional Source Beutler Lab
Gene Symbol Cenpp
Ensembl Gene ENSMUSG00000021391
Gene Namecentromere protein P
Synonyms1700022C02Rik, 4921518G09Rik
MMRRC Submission 042753-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.402) question?
Stock #R5173 (G1)
Quality Score217
Status Validated
Chromosome13
Chromosomal Location49464023-49652785 bp(-) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) CAAACCTGAAAA to CAAA at 49464782 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000021818 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021817] [ENSMUST00000021818] [ENSMUST00000220447] [ENSMUST00000220856]
Predicted Effect probably benign
Transcript: ENSMUST00000021817
SMART Domains Protein: ENSMUSP00000021817
Gene: ENSMUSG00000021385

DomainStartEndE-ValueType
Pfam:Ins_P5_2-kin 13 455 1.9e-96 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000021818
SMART Domains Protein: ENSMUSP00000021818
Gene: ENSMUSG00000021391

DomainStartEndE-ValueType
coiled coil region 1 34 N/A INTRINSIC
Pfam:CENP-P 102 278 3.9e-89 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000220447
Predicted Effect probably benign
Transcript: ENSMUST00000220856
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] CENPP is a subunit of a CENPH (MIM 605607)-CENPI (MIM 300065)-associated centromeric complex that targets CENPA (MIM 117139) to centromeres and is required for proper kinetochore function and mitotic progression (Okada et al., 2006 [PubMed 16622420]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530032D15Rik G A 1: 85,100,567 R54* probably null Het
Abca13 AC A 11: 9,682,032 probably null Het
Abca6 A T 11: 110,191,720 F1142L probably benign Het
Ap1g1 T A 8: 109,851,132 probably null Het
Apob T C 12: 8,008,238 V2207A probably benign Het
Chd3 A G 11: 69,369,243 V50A probably benign Het
Coch C A 12: 51,596,507 Y103* probably null Het
Cul3 A T 1: 80,281,416 D382E possibly damaging Het
Cul5 T C 9: 53,642,734 T291A probably benign Het
Dab1 T C 4: 104,688,448 probably null Het
Dmtf1 A G 5: 9,140,356 probably benign Het
Dpp4 T C 2: 62,387,130 Y41C probably damaging Het
Eif2ak4 A G 2: 118,408,360 I45M probably damaging Het
Epn3 T C 11: 94,496,097 K149R probably damaging Het
Flnc A G 6: 29,455,538 E2029G probably damaging Het
Gm5799 A G 14: 43,544,659 N96S probably damaging Het
Gm9573 G T 17: 35,620,741 T851N probably benign Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Grik5 T C 7: 25,062,894 H224R possibly damaging Het
Lpar6 A T 14: 73,239,097 E166V probably benign Het
Mical1 T C 10: 41,484,989 L683P probably damaging Het
Mis18bp1 T C 12: 65,149,375 I538M possibly damaging Het
Mobp A G 9: 120,168,245 R77G possibly damaging Het
Mylk A G 16: 34,977,013 H1614R probably benign Het
Olfr1179 G A 2: 88,402,922 T4I probably benign Het
Olfr1388 T C 11: 49,443,886 F12L probably benign Het
Olfr371 T C 8: 85,230,576 L27P probably damaging Het
Osbpl1a C T 18: 12,762,640 V390I probably benign Het
Pcdha7 C A 18: 36,974,652 D243E probably benign Het
Pi4ka A T 16: 17,350,906 N653K possibly damaging Het
Plin5 T G 17: 56,115,548 probably null Het
Plod1 A G 4: 147,916,301 S188P probably benign Het
Psd3 T C 8: 67,696,989 K514E probably damaging Het
Psmd11 C T 11: 80,460,740 T263I probably benign Het
Ptprt A T 2: 161,927,756 N396K probably benign Het
Rab39 T C 9: 53,686,500 E155G probably damaging Het
Rimbp2 T C 5: 128,797,648 D293G probably benign Het
Rnf220 T C 4: 117,289,274 probably benign Het
Rnmt C T 18: 68,321,359 probably benign Het
Slc10a1 T A 12: 80,956,028 I279F probably damaging Het
Taar6 A G 10: 23,985,352 Y99H probably damaging Het
Tas2r144 T A 6: 42,216,114 F263I probably benign Het
Tex15 T A 8: 33,571,740 N399K possibly damaging Het
Tlr9 T A 9: 106,225,952 V814D possibly damaging Het
Tmem53 T A 4: 117,265,711 probably benign Het
Ubap2l T C 3: 90,021,030 I511V possibly damaging Het
Vmn2r60 T C 7: 42,195,511 M766T probably damaging Het
Zfp462 T C 4: 55,011,115 V1027A probably damaging Het
Other mutations in Cenpp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00419:Cenpp APN 13 49647656 unclassified probably null
IGL01323:Cenpp APN 13 49647642 missense probably damaging 1.00
IGL01397:Cenpp APN 13 49641283 missense probably damaging 1.00
IGL01553:Cenpp APN 13 49464776 missense probably damaging 0.99
IGL02489:Cenpp APN 13 49650118 splice site probably null
IGL03024:Cenpp APN 13 49464254 missense probably benign 0.16
R0218:Cenpp UTSW 13 49647632 missense possibly damaging 0.57
R0660:Cenpp UTSW 13 49464697 missense probably benign 0.00
R1868:Cenpp UTSW 13 49641283 missense probably damaging 1.00
R4097:Cenpp UTSW 13 49493789 intron possibly damaging 0.88
R4377:Cenpp UTSW 13 49494431 intron probably benign
R4595:Cenpp UTSW 13 49641234 missense probably benign 0.09
R5174:Cenpp UTSW 13 49464782 frame shift probably null
R5953:Cenpp UTSW 13 49652685 missense probably damaging 0.99
Z1088:Cenpp UTSW 13 49647658 splice site probably null
Predicted Primers PCR Primer
(F):5'- GCTGATCTACAAAGTGCACTTTATG -3'
(R):5'- CCACACTGATGTTTGCCATGG -3'

Sequencing Primer
(F):5'- GTTGATTCTTCCCATGTAAACCCAG -3'
(R):5'- GCCATGGTGAGTACAAATTTCC -3'
Posted On2017-02-24