Incidental Mutation 'R0560:Siglec1'
ID45819
Institutional Source Beutler Lab
Gene Symbol Siglec1
Ensembl Gene ENSMUSG00000027322
Gene Namesialic acid binding Ig-like lectin 1, sialoadhesin
SynonymsSn, CD169, Siglec-1
MMRRC Submission 038752-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R0560 (G1)
Quality Score170
Status Validated
Chromosome2
Chromosomal Location131069220-131086765 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 131070346 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Asparagine at position 1692 (T1692N)
Ref Sequence ENSEMBL: ENSMUSP00000028794 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028794] [ENSMUST00000110227]
Predicted Effect probably benign
Transcript: ENSMUST00000028794
AA Change: T1692N

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000028794
Gene: ENSMUSG00000027322
AA Change: T1692N

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
IG 32 142 2.92e-5 SMART
Pfam:C2-set_2 148 235 9.4e-18 PFAM
IGc2 260 319 8.78e-9 SMART
IGc2 344 404 4.07e-4 SMART
IGc2 431 505 3.3e-4 SMART
IGc2 529 589 5.75e-4 SMART
IGc2 622 698 3.54e-4 SMART
low complexity region 700 705 N/A INTRINSIC
IG 716 795 3.35e-5 SMART
IG 804 896 6.51e-3 SMART
IGc2 909 969 4.13e-5 SMART
IG_like 1001 1076 6.78e-2 SMART
low complexity region 1077 1088 N/A INTRINSIC
IG 1094 1171 4.32e-8 SMART
IG_like 1185 1250 1.94e-2 SMART
IG 1268 1345 1.36e-5 SMART
IG_like 1354 1447 1.45e1 SMART
IG_like 1365 1435 4.51e-2 SMART
IG 1454 1534 4.56e-7 SMART
IG_like 1549 1624 1.21e-1 SMART
transmembrane domain 1647 1669 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110227
SMART Domains Protein: ENSMUSP00000105856
Gene: ENSMUSG00000027322

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
IG 32 142 2.92e-5 SMART
Pfam:C2-set_2 148 235 7e-17 PFAM
IGc2 260 319 8.78e-9 SMART
IGc2 344 404 4.07e-4 SMART
IGc2 431 505 3.3e-4 SMART
IGc2 529 589 5.75e-4 SMART
IGc2 622 698 3.54e-4 SMART
low complexity region 700 705 N/A INTRINSIC
IG 716 795 3.35e-5 SMART
IG 804 896 6.51e-3 SMART
IGc2 909 969 4.13e-5 SMART
IG_like 1001 1076 6.78e-2 SMART
low complexity region 1077 1088 N/A INTRINSIC
IG 1094 1171 4.32e-8 SMART
IG_like 1185 1250 1.94e-2 SMART
IG 1268 1345 1.36e-5 SMART
IG_like 1354 1447 1.45e1 SMART
IG_like 1365 1435 4.51e-2 SMART
IG 1454 1534 4.56e-7 SMART
Meta Mutation Damage Score 0.18 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.0%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 100% (26/26)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the immunoglobulin superfamily. The encoded protein is a lectin-like adhesion molecule that binds glycoconjugate ligands on cell surfaces in a sialic acid-dependent manner. It is a type I transmembrane protein expressed only by a subpopulation of macrophages and is involved in mediating cell-cell interactions. Alternative splicing produces a transcript variant encoding an isoform that is soluble rather than membrane-bound; however, the full-length nature of this variant has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a disruption in this gene display subtle changes in B- and T-cell populations and decreased IgM levels. Mice homozygous for a knock-out or knock-in allele exhibit impaired phagocytosis of sialylated C. jejuni. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009O20Rik T A 18: 38,254,498 L230Q probably damaging Het
AI464131 G A 4: 41,498,167 R488W probably damaging Het
Apob T C 12: 8,005,101 Y1334H probably damaging Het
Arsb A G 13: 93,790,198 T159A possibly damaging Het
Asb18 A C 1: 90,014,528 V17G probably damaging Het
Bicd1 A G 6: 149,511,962 K284E probably benign Het
Bspry A G 4: 62,486,449 R161G probably damaging Het
Ccdc138 A G 10: 58,575,717 T636A probably damaging Het
Cubn A T 2: 13,428,680 W1140R probably damaging Het
Cyp2t4 A G 7: 27,158,511 T479A probably damaging Het
Dtx3l A G 16: 35,932,935 S434P probably damaging Het
Duox2 A G 2: 122,291,554 V611A probably benign Het
Epb41l3 T G 17: 69,274,897 probably null Het
Fam161b C T 12: 84,357,718 D63N probably damaging Het
Gm5422 G A 10: 31,249,244 noncoding transcript Het
Gpr158 A T 2: 21,825,274 D710V probably damaging Het
Krtcap2 T C 3: 89,249,142 probably null Het
Mtrf1 T A 14: 79,406,850 D199E probably damaging Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Ncf2 T A 1: 152,821,522 Y47N probably damaging Het
Ovgp1 T C 3: 105,986,410 probably benign Het
Slc10a2 T C 8: 5,089,092 N284S probably benign Het
Slfn3 T C 11: 83,213,152 F283S probably damaging Het
Trank1 T C 9: 111,391,086 F2297S possibly damaging Het
Vmn2r69 A G 7: 85,409,714 probably null Het
Vps13d T C 4: 145,054,190 E3957G probably damaging Het
Other mutations in Siglec1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00482:Siglec1 APN 2 131079325 missense probably benign 0.03
IGL01092:Siglec1 APN 2 131079217 missense probably damaging 1.00
IGL01115:Siglec1 APN 2 131074502 missense probably benign 0.01
IGL01324:Siglec1 APN 2 131085541 missense probably damaging 1.00
IGL01330:Siglec1 APN 2 131083536 missense probably damaging 1.00
IGL01330:Siglec1 APN 2 131075005 nonsense probably null
IGL01558:Siglec1 APN 2 131078499 missense probably damaging 0.96
IGL01632:Siglec1 APN 2 131083820 missense probably benign 0.03
IGL01768:Siglec1 APN 2 131074394 missense probably benign
IGL02399:Siglec1 APN 2 131071178 missense probably benign 0.16
IGL02558:Siglec1 APN 2 131074995 missense possibly damaging 0.88
IGL02794:Siglec1 APN 2 131075969 missense possibly damaging 0.86
IGL02839:Siglec1 APN 2 131084932 missense possibly damaging 0.82
K3955:Siglec1 UTSW 2 131081439 missense probably benign 0.00
P0038:Siglec1 UTSW 2 131081439 missense probably benign 0.00
PIT4576001:Siglec1 UTSW 2 131078161 missense probably damaging 1.00
PIT4677001:Siglec1 UTSW 2 131072757 missense probably damaging 1.00
R0003:Siglec1 UTSW 2 131075060 missense probably benign 0.00
R0048:Siglec1 UTSW 2 131073397 missense possibly damaging 0.65
R0048:Siglec1 UTSW 2 131073397 missense possibly damaging 0.65
R0243:Siglec1 UTSW 2 131085476 missense probably damaging 1.00
R0276:Siglec1 UTSW 2 131083941 nonsense probably null
R0379:Siglec1 UTSW 2 131074525 splice site probably benign
R0464:Siglec1 UTSW 2 131079359 missense probably damaging 1.00
R0507:Siglec1 UTSW 2 131074525 splice site probably benign
R0620:Siglec1 UTSW 2 131074268 missense probably benign 0.30
R0621:Siglec1 UTSW 2 131074268 missense probably benign 0.30
R0853:Siglec1 UTSW 2 131085022 missense probably damaging 0.98
R1079:Siglec1 UTSW 2 131079377 nonsense probably null
R1169:Siglec1 UTSW 2 131074827 missense probably damaging 0.97
R1205:Siglec1 UTSW 2 131080464 missense possibly damaging 0.94
R1293:Siglec1 UTSW 2 131073531 missense probably benign 0.00
R1470:Siglec1 UTSW 2 131070387 missense probably benign 0.19
R1470:Siglec1 UTSW 2 131070387 missense probably benign 0.19
R1533:Siglec1 UTSW 2 131076158 missense probably benign
R1717:Siglec1 UTSW 2 131073956 missense possibly damaging 0.92
R1717:Siglec1 UTSW 2 131084012 missense probably damaging 1.00
R1744:Siglec1 UTSW 2 131081299 missense probably damaging 1.00
R1852:Siglec1 UTSW 2 131081500 missense probably damaging 0.98
R1941:Siglec1 UTSW 2 131078131 missense possibly damaging 0.94
R2011:Siglec1 UTSW 2 131083357 missense probably damaging 1.00
R2012:Siglec1 UTSW 2 131083357 missense probably damaging 1.00
R2128:Siglec1 UTSW 2 131080497 missense probably damaging 1.00
R2278:Siglec1 UTSW 2 131071337 missense probably benign 0.28
R2403:Siglec1 UTSW 2 131074475 missense possibly damaging 0.65
R2449:Siglec1 UTSW 2 131078725 missense probably benign 0.44
R2885:Siglec1 UTSW 2 131072747 missense possibly damaging 0.88
R4213:Siglec1 UTSW 2 131074118 missense probably damaging 1.00
R4274:Siglec1 UTSW 2 131085814 missense probably benign 0.00
R4679:Siglec1 UTSW 2 131073411 missense possibly damaging 0.87
R4715:Siglec1 UTSW 2 131074436 missense probably damaging 1.00
R4782:Siglec1 UTSW 2 131075923 missense probably damaging 1.00
R4896:Siglec1 UTSW 2 131069869 missense probably benign 0.21
R4993:Siglec1 UTSW 2 131073361 missense possibly damaging 0.93
R5004:Siglec1 UTSW 2 131069869 missense probably benign 0.21
R5004:Siglec1 UTSW 2 131073411 missense possibly damaging 0.87
R5105:Siglec1 UTSW 2 131080400 missense possibly damaging 0.69
R5137:Siglec1 UTSW 2 131081344 missense probably damaging 1.00
R5153:Siglec1 UTSW 2 131085577 missense probably damaging 0.99
R5311:Siglec1 UTSW 2 131079316 missense probably damaging 1.00
R5600:Siglec1 UTSW 2 131085583 missense probably benign 0.01
R5682:Siglec1 UTSW 2 131084010 missense probably damaging 1.00
R5732:Siglec1 UTSW 2 131074268 missense probably benign 0.30
R5870:Siglec1 UTSW 2 131072847 missense probably damaging 0.99
R5898:Siglec1 UTSW 2 131073633 missense probably damaging 1.00
R5909:Siglec1 UTSW 2 131077964 missense probably damaging 1.00
R6488:Siglec1 UTSW 2 131081307 missense probably damaging 0.99
R6920:Siglec1 UTSW 2 131078077 nonsense probably null
R7064:Siglec1 UTSW 2 131083914 missense probably benign 0.00
R7270:Siglec1 UTSW 2 131081551 missense possibly damaging 0.67
X0024:Siglec1 UTSW 2 131080491 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGTCTCTGTCAGAACTGCTCTCC -3'
(R):5'- AGTCCACAGGCTTCAAATTTCCCAC -3'

Sequencing Primer
(F):5'- GTCAGAACTGCTCTCCCTATTC -3'
(R):5'- TTCCTTCGCTGGAAAAGGC -3'
Posted On2013-06-11