Incidental Mutation 'R0560:Krtcap2'
ID45821
Institutional Source Beutler Lab
Gene Symbol Krtcap2
Ensembl Gene ENSMUSG00000042747
Gene Namekeratinocyte associated protein 2
Synonyms0610010I12Rik
MMRRC Submission 038752-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.144) question?
Stock #R0560 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location89245966-89249906 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 89249142 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000130372 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040888] [ENSMUST00000041022] [ENSMUST00000090924] [ENSMUST00000107464] [ENSMUST00000125952] [ENSMUST00000143637] [ENSMUST00000168900]
Predicted Effect probably null
Transcript: ENSMUST00000040888
SMART Domains Protein: ENSMUSP00000043540
Gene: ENSMUSG00000042747

DomainStartEndE-ValueType
Pfam:Keratin_assoc 87 215 2.5e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000041022
SMART Domains Protein: ENSMUSP00000036053
Gene: ENSMUSG00000042766

DomainStartEndE-ValueType
RING 33 133 1.92e-6 SMART
BBOX 222 263 9.59e-7 SMART
Blast:BBC 271 395 3e-13 BLAST
FN3 430 515 2.03e-2 SMART
low complexity region 561 571 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000090924
SMART Domains Protein: ENSMUSP00000088442
Gene: ENSMUSG00000042766

DomainStartEndE-ValueType
RING 20 120 1.92e-6 SMART
BBOX 209 250 9.59e-7 SMART
Blast:BBC 258 382 8e-13 BLAST
FN3 417 502 2.03e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107464
SMART Domains Protein: ENSMUSP00000103088
Gene: ENSMUSG00000042766

DomainStartEndE-ValueType
RING 10 110 1.92e-6 SMART
BBOX 199 240 9.59e-7 SMART
Blast:BBC 248 372 2e-13 BLAST
FN3 407 492 2.03e-2 SMART
low complexity region 538 548 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125952
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126691
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132818
Predicted Effect probably benign
Transcript: ENSMUST00000143637
SMART Domains Protein: ENSMUSP00000119270
Gene: ENSMUSG00000042766

DomainStartEndE-ValueType
RING 33 133 1.92e-6 SMART
BBOX 222 263 9.59e-7 SMART
Blast:BBC 270 391 4e-11 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000168900
SMART Domains Protein: ENSMUSP00000130372
Gene: ENSMUSG00000042747

DomainStartEndE-ValueType
Pfam:Keratin_assoc 1 134 1.2e-61 PFAM
Meta Mutation Damage Score 0.55 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.0%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 100% (26/26)
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009O20Rik T A 18: 38,254,498 L230Q probably damaging Het
AI464131 G A 4: 41,498,167 R488W probably damaging Het
Apob T C 12: 8,005,101 Y1334H probably damaging Het
Arsb A G 13: 93,790,198 T159A possibly damaging Het
Asb18 A C 1: 90,014,528 V17G probably damaging Het
Bicd1 A G 6: 149,511,962 K284E probably benign Het
Bspry A G 4: 62,486,449 R161G probably damaging Het
Ccdc138 A G 10: 58,575,717 T636A probably damaging Het
Cubn A T 2: 13,428,680 W1140R probably damaging Het
Cyp2t4 A G 7: 27,158,511 T479A probably damaging Het
Dtx3l A G 16: 35,932,935 S434P probably damaging Het
Duox2 A G 2: 122,291,554 V611A probably benign Het
Epb41l3 T G 17: 69,274,897 probably null Het
Fam161b C T 12: 84,357,718 D63N probably damaging Het
Gm5422 G A 10: 31,249,244 noncoding transcript Het
Gpr158 A T 2: 21,825,274 D710V probably damaging Het
Mtrf1 T A 14: 79,406,850 D199E probably damaging Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Ncf2 T A 1: 152,821,522 Y47N probably damaging Het
Ovgp1 T C 3: 105,986,410 probably benign Het
Siglec1 G T 2: 131,070,346 T1692N probably benign Het
Slc10a2 T C 8: 5,089,092 N284S probably benign Het
Slfn3 T C 11: 83,213,152 F283S probably damaging Het
Trank1 T C 9: 111,391,086 F2297S possibly damaging Het
Vmn2r69 A G 7: 85,409,714 probably null Het
Vps13d T C 4: 145,054,190 E3957G probably damaging Het
Other mutations in Krtcap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1930:Krtcap2 UTSW 3 89247076 missense probably damaging 1.00
R4504:Krtcap2 UTSW 3 89246256 unclassified probably benign
R4505:Krtcap2 UTSW 3 89246256 unclassified probably benign
R4506:Krtcap2 UTSW 3 89246256 unclassified probably benign
R4507:Krtcap2 UTSW 3 89246256 unclassified probably benign
R5109:Krtcap2 UTSW 3 89246778 missense probably benign
R5392:Krtcap2 UTSW 3 89246879 missense probably benign 0.01
R6363:Krtcap2 UTSW 3 89249106 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACGTTTTCAAGCAGGTTCCTCACAG -3'
(R):5'- TGTTGCTACTAGGGCAGACACCAG -3'

Sequencing Primer
(F):5'- GGTTCCTCACAGGGTTCTAGAC -3'
(R):5'- tggggagatggctcagg -3'
Posted On2013-06-11