Incidental Mutation 'R0560:AI464131'
ID45823
Institutional Source Beutler Lab
Gene Symbol AI464131
Ensembl Gene ENSMUSG00000046312
Gene Nameexpressed sequence AI464131
SynonymsNET37
MMRRC Submission 038752-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.246) question?
Stock #R0560 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location41495604-41503076 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 41498167 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 488 (R488W)
Ref Sequence ENSEMBL: ENSMUSP00000059038 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054920] [ENSMUST00000149596]
Predicted Effect probably damaging
Transcript: ENSMUST00000054920
AA Change: R488W

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000059038
Gene: ENSMUSG00000046312
AA Change: R488W

DomainStartEndE-ValueType
transmembrane domain 56 78 N/A INTRINSIC
Pfam:Glyco_hydro_31 311 712 9.7e-55 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149596
Meta Mutation Damage Score 0.0264 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.0%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 100% (26/26)
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009O20Rik T A 18: 38,254,498 L230Q probably damaging Het
Apob T C 12: 8,005,101 Y1334H probably damaging Het
Arsb A G 13: 93,790,198 T159A possibly damaging Het
Asb18 A C 1: 90,014,528 V17G probably damaging Het
Bicd1 A G 6: 149,511,962 K284E probably benign Het
Bspry A G 4: 62,486,449 R161G probably damaging Het
Ccdc138 A G 10: 58,575,717 T636A probably damaging Het
Cubn A T 2: 13,428,680 W1140R probably damaging Het
Cyp2t4 A G 7: 27,158,511 T479A probably damaging Het
Dtx3l A G 16: 35,932,935 S434P probably damaging Het
Duox2 A G 2: 122,291,554 V611A probably benign Het
Epb41l3 T G 17: 69,274,897 probably null Het
Fam161b C T 12: 84,357,718 D63N probably damaging Het
Gm5422 G A 10: 31,249,244 noncoding transcript Het
Gpr158 A T 2: 21,825,274 D710V probably damaging Het
Krtcap2 T C 3: 89,249,142 probably null Het
Mtrf1 T A 14: 79,406,850 D199E probably damaging Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Ncf2 T A 1: 152,821,522 Y47N probably damaging Het
Ovgp1 T C 3: 105,986,410 probably benign Het
Siglec1 G T 2: 131,070,346 T1692N probably benign Het
Slc10a2 T C 8: 5,089,092 N284S probably benign Het
Slfn3 T C 11: 83,213,152 F283S probably damaging Het
Trank1 T C 9: 111,391,086 F2297S possibly damaging Het
Vmn2r69 A G 7: 85,409,714 probably null Het
Vps13d T C 4: 145,054,190 E3957G probably damaging Het
Other mutations in AI464131
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01287:AI464131 APN 4 41498923 missense possibly damaging 0.68
IGL01352:AI464131 APN 4 41499469 nonsense probably null
IGL01384:AI464131 APN 4 41498151 missense probably damaging 0.99
IGL02150:AI464131 APN 4 41499183 missense possibly damaging 0.48
IGL02557:AI464131 APN 4 41497900 missense possibly damaging 0.51
R0238:AI464131 UTSW 4 41498912 missense probably benign 0.11
R0238:AI464131 UTSW 4 41498912 missense probably benign 0.11
R0413:AI464131 UTSW 4 41498585 missense probably benign 0.00
R0455:AI464131 UTSW 4 41499538 nonsense probably null
R0511:AI464131 UTSW 4 41498538 missense probably damaging 0.96
R0785:AI464131 UTSW 4 41497539 missense probably benign 0.02
R0940:AI464131 UTSW 4 41497996 missense probably damaging 1.00
R1677:AI464131 UTSW 4 41497947 missense probably benign 0.00
R1762:AI464131 UTSW 4 41498553 missense possibly damaging 0.91
R1984:AI464131 UTSW 4 41497501 missense possibly damaging 0.95
R2192:AI464131 UTSW 4 41497704 missense probably damaging 0.99
R2496:AI464131 UTSW 4 41499165 missense probably benign 0.28
R4212:AI464131 UTSW 4 41498307 missense probably benign 0.01
R4321:AI464131 UTSW 4 41498767 missense probably benign 0.00
R4672:AI464131 UTSW 4 41499061 missense probably benign 0.00
R4890:AI464131 UTSW 4 41498877 missense probably benign 0.00
R4954:AI464131 UTSW 4 41498241 missense possibly damaging 0.89
R5177:AI464131 UTSW 4 41498407 nonsense probably null
R5967:AI464131 UTSW 4 41497830 missense probably benign 0.00
R6005:AI464131 UTSW 4 41498895 missense probably benign 0.31
R6128:AI464131 UTSW 4 41498445 missense probably damaging 1.00
R6162:AI464131 UTSW 4 41497899 missense possibly damaging 0.51
R7202:AI464131 UTSW 4 41498268 missense probably damaging 0.99
R7211:AI464131 UTSW 4 41498028 missense probably damaging 1.00
R7311:AI464131 UTSW 4 41498577 missense probably damaging 1.00
X0024:AI464131 UTSW 4 41498107 missense possibly damaging 0.92
Z1088:AI464131 UTSW 4 41497557 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GAACGGATAGCCCAGCATACTGAC -3'
(R):5'- GCCCGCCTATGGCGACTTTAATTTC -3'

Sequencing Primer
(F):5'- CCAGCATACTGACGGTGAG -3'
(R):5'- CGACTTTAATTTCGACGAGGGC -3'
Posted On2013-06-11