Incidental Mutation 'R0560:Vmn2r69'
ID45830
Institutional Source Beutler Lab
Gene Symbol Vmn2r69
Ensembl Gene ENSMUSG00000091006
Gene Namevomeronasal 2, receptor 69
Synonyms
MMRRC Submission 038752-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.165) question?
Stock #R0560 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location85404849-85417476 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 85409714 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000132726 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000171213]
Predicted Effect probably null
Transcript: ENSMUST00000171213
SMART Domains Protein: ENSMUSP00000132726
Gene: ENSMUSG00000091006

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 77 465 1.3e-28 PFAM
Pfam:NCD3G 507 559 1.8e-20 PFAM
Pfam:7tm_3 592 827 3.2e-54 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207880
Meta Mutation Damage Score 0.6184 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.0%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 100% (26/26)
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009O20Rik T A 18: 38,254,498 L230Q probably damaging Het
AI464131 G A 4: 41,498,167 R488W probably damaging Het
Apob T C 12: 8,005,101 Y1334H probably damaging Het
Arsb A G 13: 93,790,198 T159A possibly damaging Het
Asb18 A C 1: 90,014,528 V17G probably damaging Het
Bicd1 A G 6: 149,511,962 K284E probably benign Het
Bspry A G 4: 62,486,449 R161G probably damaging Het
Ccdc138 A G 10: 58,575,717 T636A probably damaging Het
Cubn A T 2: 13,428,680 W1140R probably damaging Het
Cyp2t4 A G 7: 27,158,511 T479A probably damaging Het
Dtx3l A G 16: 35,932,935 S434P probably damaging Het
Duox2 A G 2: 122,291,554 V611A probably benign Het
Epb41l3 T G 17: 69,274,897 probably null Het
Fam161b C T 12: 84,357,718 D63N probably damaging Het
Gm5422 G A 10: 31,249,244 noncoding transcript Het
Gpr158 A T 2: 21,825,274 D710V probably damaging Het
Krtcap2 T C 3: 89,249,142 probably null Het
Mtrf1 T A 14: 79,406,850 D199E probably damaging Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Ncf2 T A 1: 152,821,522 Y47N probably damaging Het
Ovgp1 T C 3: 105,986,410 probably benign Het
Siglec1 G T 2: 131,070,346 T1692N probably benign Het
Slc10a2 T C 8: 5,089,092 N284S probably benign Het
Slfn3 T C 11: 83,213,152 F283S probably damaging Het
Trank1 T C 9: 111,391,086 F2297S possibly damaging Het
Vps13d T C 4: 145,054,190 E3957G probably damaging Het
Other mutations in Vmn2r69
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01019:Vmn2r69 APN 7 85406531 missense probably benign
IGL01457:Vmn2r69 APN 7 85406628 missense possibly damaging 0.87
IGL01760:Vmn2r69 APN 7 85406864 missense possibly damaging 0.90
IGL01834:Vmn2r69 APN 7 85412368 missense probably damaging 1.00
IGL02001:Vmn2r69 APN 7 85407226 missense probably benign 0.05
IGL02057:Vmn2r69 APN 7 85411782 missense possibly damaging 0.93
IGL02289:Vmn2r69 APN 7 85406846 missense probably damaging 1.00
IGL02472:Vmn2r69 APN 7 85409752 missense probably benign 0.01
IGL02478:Vmn2r69 APN 7 85406681 missense probably damaging 1.00
IGL02554:Vmn2r69 APN 7 85409806 missense probably damaging 1.00
IGL02723:Vmn2r69 APN 7 85410208 missense probably damaging 1.00
R0526:Vmn2r69 UTSW 7 85411503 missense probably damaging 1.00
R0909:Vmn2r69 UTSW 7 85406665 missense probably benign 0.00
R0976:Vmn2r69 UTSW 7 85406900 missense probably damaging 1.00
R1158:Vmn2r69 UTSW 7 85409850 splice site probably benign
R1459:Vmn2r69 UTSW 7 85406700 nonsense probably null
R1482:Vmn2r69 UTSW 7 85406874 missense probably damaging 1.00
R1917:Vmn2r69 UTSW 7 85411683 missense probably damaging 1.00
R2016:Vmn2r69 UTSW 7 85407285 missense probably damaging 0.98
R2108:Vmn2r69 UTSW 7 85410196 missense probably benign
R2571:Vmn2r69 UTSW 7 85415556 missense probably benign
R2910:Vmn2r69 UTSW 7 85406710 missense probably damaging 1.00
R2920:Vmn2r69 UTSW 7 85411765 missense probably benign 0.08
R3708:Vmn2r69 UTSW 7 85411821 missense probably damaging 0.98
R3710:Vmn2r69 UTSW 7 85406393 missense probably benign
R4757:Vmn2r69 UTSW 7 85412367 missense probably damaging 0.99
R4823:Vmn2r69 UTSW 7 85411300 missense probably benign 0.21
R4870:Vmn2r69 UTSW 7 85411585 missense possibly damaging 0.93
R4918:Vmn2r69 UTSW 7 85406759 missense probably benign 0.06
R5022:Vmn2r69 UTSW 7 85411159 missense possibly damaging 0.72
R5174:Vmn2r69 UTSW 7 85415531 missense possibly damaging 0.92
R5200:Vmn2r69 UTSW 7 85406509 missense probably damaging 1.00
R5278:Vmn2r69 UTSW 7 85411783 missense probably benign 0.02
R5643:Vmn2r69 UTSW 7 85407196 missense probably damaging 0.98
R5996:Vmn2r69 UTSW 7 85411909 splice site probably null
R6083:Vmn2r69 UTSW 7 85406503 missense probably damaging 1.00
R6140:Vmn2r69 UTSW 7 85411449 missense probably damaging 0.99
R6306:Vmn2r69 UTSW 7 85415591 missense probably benign 0.04
R6330:Vmn2r69 UTSW 7 85411627 missense probably benign
R6380:Vmn2r69 UTSW 7 85411859 missense probably benign
R6466:Vmn2r69 UTSW 7 85407170 missense probably benign 0.01
R6542:Vmn2r69 UTSW 7 85411205 nonsense probably null
R6583:Vmn2r69 UTSW 7 85409809 missense probably benign
R6623:Vmn2r69 UTSW 7 85407101 missense possibly damaging 0.84
R6709:Vmn2r69 UTSW 7 85411861 missense probably benign 0.03
R6732:Vmn2r69 UTSW 7 85411143 missense probably benign 0.00
R6741:Vmn2r69 UTSW 7 85412516 missense probably benign 0.01
R7070:Vmn2r69 UTSW 7 85411480 missense probably damaging 0.98
R7234:Vmn2r69 UTSW 7 85407107 missense probably benign 0.22
R7323:Vmn2r69 UTSW 7 85411764 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TCCAGGGATCTACAATAGTGAGGCAAA -3'
(R):5'- GCATCTTCCAAGTGGTCAACAGCTATA -3'

Sequencing Primer
(F):5'- CAATAGTGAGGCAAAAATACAGTTC -3'
(R):5'- CAGGAATCTCTGTTGTGGGAATC -3'
Posted On2013-06-11