Incidental Mutation 'R0560:Gm5422'
ID45836
Institutional Source Beutler Lab
Gene Symbol Gm5422
Ensembl Gene ENSMUSG00000039684
Gene Namepredicted pseudogene 5422
Synonyms
MMRRC Submission 038752-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.793) question?
Stock #R0560 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location31248140-31251045 bp(+) (GRCm38)
Type of Mutationexon
DNA Base Change (assembly) G to A at 31249244 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
Predicted Effect noncoding transcript
Transcript: ENSMUST00000050717
SMART Domains Protein: ENSMUSP00000135967
Gene: ENSMUSG00000039684

DomainStartEndE-ValueType
low complexity region 44 61 N/A INTRINSIC
Pfam:PC_rep 438 474 6.8e-9 PFAM
Pfam:PC_rep 475 509 1.1e-8 PFAM
SCOP:d1gw5a_ 603 760 4e-4 SMART
PDB:4CR4|Z 648 901 1e-50 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216161
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.0%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 100% (26/26)
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009O20Rik T A 18: 38,254,498 L230Q probably damaging Het
AI464131 G A 4: 41,498,167 R488W probably damaging Het
Apob T C 12: 8,005,101 Y1334H probably damaging Het
Arsb A G 13: 93,790,198 T159A possibly damaging Het
Asb18 A C 1: 90,014,528 V17G probably damaging Het
Bicd1 A G 6: 149,511,962 K284E probably benign Het
Bspry A G 4: 62,486,449 R161G probably damaging Het
Ccdc138 A G 10: 58,575,717 T636A probably damaging Het
Cubn A T 2: 13,428,680 W1140R probably damaging Het
Cyp2t4 A G 7: 27,158,511 T479A probably damaging Het
Dtx3l A G 16: 35,932,935 S434P probably damaging Het
Duox2 A G 2: 122,291,554 V611A probably benign Het
Epb41l3 T G 17: 69,274,897 probably null Het
Fam161b C T 12: 84,357,718 D63N probably damaging Het
Gpr158 A T 2: 21,825,274 D710V probably damaging Het
Krtcap2 T C 3: 89,249,142 probably null Het
Mtrf1 T A 14: 79,406,850 D199E probably damaging Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Ncf2 T A 1: 152,821,522 Y47N probably damaging Het
Ovgp1 T C 3: 105,986,410 probably benign Het
Siglec1 G T 2: 131,070,346 T1692N probably benign Het
Slc10a2 T C 8: 5,089,092 N284S probably benign Het
Slfn3 T C 11: 83,213,152 F283S probably damaging Het
Trank1 T C 9: 111,391,086 F2297S possibly damaging Het
Vmn2r69 A G 7: 85,409,714 probably null Het
Vps13d T C 4: 145,054,190 E3957G probably damaging Het
Other mutations in Gm5422
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01306:Gm5422 APN 10 31249436 exon noncoding transcript
IGL01569:Gm5422 APN 10 31249901 exon noncoding transcript
IGL01645:Gm5422 APN 10 31250073 exon noncoding transcript
IGL02273:Gm5422 APN 10 31250007 exon noncoding transcript
IGL02603:Gm5422 APN 10 31249440 exon noncoding transcript
IGL02928:Gm5422 APN 10 31250254 exon noncoding transcript
IGL03003:Gm5422 APN 10 31250844 exon noncoding transcript
IGL03274:Gm5422 APN 10 31250352 exon noncoding transcript
IGL03297:Gm5422 APN 10 31249731 exon noncoding transcript
ANU23:Gm5422 UTSW 10 31249436 exon noncoding transcript
R0010:Gm5422 UTSW 10 31249754 exon noncoding transcript
R0506:Gm5422 UTSW 10 31250322 exon noncoding transcript
R0573:Gm5422 UTSW 10 31250160 exon noncoding transcript
R0652:Gm5422 UTSW 10 31249281 exon noncoding transcript
R1210:Gm5422 UTSW 10 31250723 intron noncoding transcript
R1259:Gm5422 UTSW 10 31249115 exon noncoding transcript
R1352:Gm5422 UTSW 10 31250735 intron noncoding transcript
R1631:Gm5422 UTSW 10 31249806 exon noncoding transcript
R1707:Gm5422 UTSW 10 31248462 exon noncoding transcript
R1893:Gm5422 UTSW 10 31249613 exon noncoding transcript
R2011:Gm5422 UTSW 10 31248768 exon noncoding transcript
R2132:Gm5422 UTSW 10 31248933 exon noncoding transcript
R3427:Gm5422 UTSW 10 31248846 exon noncoding transcript
R3772:Gm5422 UTSW 10 31248514 exon noncoding transcript
R4703:Gm5422 UTSW 10 31249612 exon noncoding transcript
R5539:Gm5422 UTSW 10 31248650 exon noncoding transcript
R5603:Gm5422 UTSW 10 31250844 exon noncoding transcript
R5660:Gm5422 UTSW 10 31250052 exon noncoding transcript
R6124:Gm5422 UTSW 10 31249400 exon noncoding transcript
R6178:Gm5422 UTSW 10 31249692 exon noncoding transcript
Predicted Primers PCR Primer
(F):5'- TGTTCCGAAAGTTTAGCCGTTTCCC -3'
(R):5'- ATCATGCCAAGAGACGCAGCAG -3'

Sequencing Primer
(F):5'- TGGCACTGATGCTCAATGAC -3'
(R):5'- GAGACGCAGCAGCACTTAAC -3'
Posted On2013-06-11