Incidental Mutation 'R0560:Fam161b'
ID45840
Institutional Source Beutler Lab
Gene Symbol Fam161b
Ensembl Gene ENSMUSG00000021234
Gene Namefamily with sequence similarity 161, member B
Synonyms
MMRRC Submission 038752-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #R0560 (G1)
Quality Score189
Status Validated
Chromosome12
Chromosomal Location84345309-84361833 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 84357718 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 63 (D63N)
Ref Sequence ENSEMBL: ENSMUSP00000070407 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021659] [ENSMUST00000021661] [ENSMUST00000065536] [ENSMUST00000110276] [ENSMUST00000110278] [ENSMUST00000152913]
Predicted Effect probably damaging
Transcript: ENSMUST00000021659
AA Change: D63N

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000021659
Gene: ENSMUSG00000021234
AA Change: D63N

DomainStartEndE-ValueType
low complexity region 57 65 N/A INTRINSIC
low complexity region 93 107 N/A INTRINSIC
Pfam:UPF0564 168 535 5.3e-100 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000021661
SMART Domains Protein: ENSMUSP00000021661
Gene: ENSMUSG00000021235

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 46 56 N/A INTRINSIC
Pfam:FAD_binding_3 195 328 3.9e-8 PFAM
Pfam:FAD_binding_3 334 435 1.3e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000065536
AA Change: D63N

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000070407
Gene: ENSMUSG00000021234
AA Change: D63N

DomainStartEndE-ValueType
low complexity region 57 65 N/A INTRINSIC
low complexity region 93 107 N/A INTRINSIC
Pfam:UPF0564 168 535 8.3e-112 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110276
SMART Domains Protein: ENSMUSP00000105905
Gene: ENSMUSG00000021235

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 46 56 N/A INTRINSIC
Pfam:FAD_binding_3 195 328 5.1e-8 PFAM
Pfam:FAD_binding_3 334 435 1.7e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110278
SMART Domains Protein: ENSMUSP00000105907
Gene: ENSMUSG00000021235

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 46 56 N/A INTRINSIC
Pfam:FAD_binding_3 195 328 6.8e-8 PFAM
Pfam:FAD_binding_3 334 410 1.1e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124257
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126752
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133230
Predicted Effect probably benign
Transcript: ENSMUST00000145522
SMART Domains Protein: ENSMUSP00000117609
Gene: ENSMUSG00000021235

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
SCOP:d1foha5 35 167 2e-6 SMART
PDB:4K22|B 90 156 3e-8 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150391
Predicted Effect probably benign
Transcript: ENSMUST00000152913
SMART Domains Protein: ENSMUSP00000115676
Gene: ENSMUSG00000021235

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
SCOP:d1foha5 39 269 1e-10 SMART
PDB:4K22|B 94 274 1e-20 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153450
Meta Mutation Damage Score 0.09 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.0%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 100% (26/26)
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009O20Rik T A 18: 38,254,498 L230Q probably damaging Het
AI464131 G A 4: 41,498,167 R488W probably damaging Het
Apob T C 12: 8,005,101 Y1334H probably damaging Het
Arsb A G 13: 93,790,198 T159A possibly damaging Het
Asb18 A C 1: 90,014,528 V17G probably damaging Het
Bicd1 A G 6: 149,511,962 K284E probably benign Het
Bspry A G 4: 62,486,449 R161G probably damaging Het
Ccdc138 A G 10: 58,575,717 T636A probably damaging Het
Cubn A T 2: 13,428,680 W1140R probably damaging Het
Cyp2t4 A G 7: 27,158,511 T479A probably damaging Het
Dtx3l A G 16: 35,932,935 S434P probably damaging Het
Duox2 A G 2: 122,291,554 V611A probably benign Het
Epb41l3 T G 17: 69,274,897 probably null Het
Gm5422 G A 10: 31,249,244 noncoding transcript Het
Gpr158 A T 2: 21,825,274 D710V probably damaging Het
Krtcap2 T C 3: 89,249,142 probably null Het
Mtrf1 T A 14: 79,406,850 D199E probably damaging Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Ncf2 T A 1: 152,821,522 Y47N probably damaging Het
Ovgp1 T C 3: 105,986,410 probably benign Het
Siglec1 G T 2: 131,070,346 T1692N probably benign Het
Slc10a2 T C 8: 5,089,092 N284S probably benign Het
Slfn3 T C 11: 83,213,152 F283S probably damaging Het
Trank1 T C 9: 111,391,086 F2297S possibly damaging Het
Vmn2r69 A G 7: 85,409,714 probably null Het
Vps13d T C 4: 145,054,190 E3957G probably damaging Het
Other mutations in Fam161b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00540:Fam161b APN 12 84361751 unclassified probably benign
IGL00900:Fam161b APN 12 84355969 missense probably benign 0.05
IGL00905:Fam161b APN 12 84357685 missense probably benign 0.00
IGL01123:Fam161b APN 12 84357664 missense probably benign 0.00
IGL02156:Fam161b APN 12 84354753 missense probably benign 0.00
IGL02630:Fam161b APN 12 84353914 missense probably benign 0.03
IGL02670:Fam161b APN 12 84357594 missense probably benign 0.00
IGL03160:Fam161b APN 12 84353825 missense probably benign 0.05
R0569:Fam161b UTSW 12 84348639 missense probably damaging 1.00
R1834:Fam161b UTSW 12 84348778 splice site probably benign
R2070:Fam161b UTSW 12 84356428 missense probably benign 0.00
R3784:Fam161b UTSW 12 84361690 critical splice donor site probably null
R3786:Fam161b UTSW 12 84361690 critical splice donor site probably null
R4697:Fam161b UTSW 12 84348558 unclassified probably benign
R5247:Fam161b UTSW 12 84357750 missense probably damaging 1.00
R5390:Fam161b UTSW 12 84348634 missense probably damaging 0.99
R5668:Fam161b UTSW 12 84356350 missense probably damaging 0.96
R6891:Fam161b UTSW 12 84354780 missense probably damaging 1.00
R7189:Fam161b UTSW 12 84348646 missense probably damaging 1.00
X0019:Fam161b UTSW 12 84354973 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- CCTGCTCTTGTCTTGGAAGAAGCTC -3'
(R):5'- ACACGCTGTGTTGTTCAGTGCC -3'

Sequencing Primer
(F):5'- TTGGAAGAAGCTCTCCAAGTC -3'
(R):5'- AGACACTGAGCCAGAAGATG -3'
Posted On2013-06-11