Incidental Mutation 'R0560:Epb41l3'
ID45846
Institutional Source Beutler Lab
Gene Symbol Epb41l3
Ensembl Gene ENSMUSG00000024044
Gene Nameerythrocyte membrane protein band 4.1 like 3
SynonymsDAL1P, NBL3, Epb4.1l3, 4.1B
MMRRC Submission 038752-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0560 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location69075683-69289989 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to G at 69274897 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000153228 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080208] [ENSMUST00000112680] [ENSMUST00000225695] [ENSMUST00000225740] [ENSMUST00000225977]
Predicted Effect probably null
Transcript: ENSMUST00000080208
SMART Domains Protein: ENSMUSP00000079098
Gene: ENSMUSG00000024044

DomainStartEndE-ValueType
low complexity region 15 40 N/A INTRINSIC
low complexity region 94 107 N/A INTRINSIC
B41 114 309 1.13e-80 SMART
FERM_C 313 403 3.96e-38 SMART
FA 405 451 2.34e-17 SMART
low complexity region 497 517 N/A INTRINSIC
Pfam:SAB 556 604 2.1e-29 PFAM
low complexity region 789 802 N/A INTRINSIC
Pfam:4_1_CTD 809 922 1.9e-59 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000112680
SMART Domains Protein: ENSMUSP00000108300
Gene: ENSMUSG00000024044

DomainStartEndE-ValueType
low complexity region 15 40 N/A INTRINSIC
low complexity region 94 107 N/A INTRINSIC
B41 114 309 1.13e-80 SMART
FERM_C 313 403 3.96e-38 SMART
FA 405 451 2.34e-17 SMART
low complexity region 497 517 N/A INTRINSIC
Pfam:SAB 566 614 3.2e-28 PFAM
low complexity region 799 812 N/A INTRINSIC
Pfam:4_1_CTD 825 931 2.9e-55 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187090
Predicted Effect probably null
Transcript: ENSMUST00000223703
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223816
Predicted Effect probably null
Transcript: ENSMUST00000224523
Predicted Effect probably null
Transcript: ENSMUST00000224951
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225316
Predicted Effect probably null
Transcript: ENSMUST00000225695
Predicted Effect probably benign
Transcript: ENSMUST00000225740
Predicted Effect probably null
Transcript: ENSMUST00000225977
Meta Mutation Damage Score 0.488 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.0%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 100% (26/26)
MGI Phenotype PHENOTYPE: Mice homozygous for one knock-out allele display a normal phenotype. Mice homozygous for a different knock-out allele exhibit ataxia, gait abnormalities, clasping, hypermyelination, abnormal axon morphology, and decreased internode length. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009O20Rik T A 18: 38,254,498 L230Q probably damaging Het
AI464131 G A 4: 41,498,167 R488W probably damaging Het
Apob T C 12: 8,005,101 Y1334H probably damaging Het
Arsb A G 13: 93,790,198 T159A possibly damaging Het
Asb18 A C 1: 90,014,528 V17G probably damaging Het
Bicd1 A G 6: 149,511,962 K284E probably benign Het
Bspry A G 4: 62,486,449 R161G probably damaging Het
Ccdc138 A G 10: 58,575,717 T636A probably damaging Het
Cubn A T 2: 13,428,680 W1140R probably damaging Het
Cyp2t4 A G 7: 27,158,511 T479A probably damaging Het
Dtx3l A G 16: 35,932,935 S434P probably damaging Het
Duox2 A G 2: 122,291,554 V611A probably benign Het
Fam161b C T 12: 84,357,718 D63N probably damaging Het
Gm5422 G A 10: 31,249,244 noncoding transcript Het
Gpr158 A T 2: 21,825,274 D710V probably damaging Het
Krtcap2 T C 3: 89,249,142 probably null Het
Mtrf1 T A 14: 79,406,850 D199E probably damaging Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Ncf2 T A 1: 152,821,522 Y47N probably damaging Het
Ovgp1 T C 3: 105,986,410 probably benign Het
Siglec1 G T 2: 131,070,346 T1692N probably benign Het
Slc10a2 T C 8: 5,089,092 N284S probably benign Het
Slfn3 T C 11: 83,213,152 F283S probably damaging Het
Trank1 T C 9: 111,391,086 F2297S possibly damaging Het
Vmn2r69 A G 7: 85,409,714 probably null Het
Vps13d T C 4: 145,054,190 E3957G probably damaging Het
Other mutations in Epb41l3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00975:Epb41l3 APN 17 69207861 splice site probably benign
IGL01099:Epb41l3 APN 17 69210193 missense possibly damaging 0.80
IGL01578:Epb41l3 APN 17 69248709 missense probably damaging 1.00
IGL02269:Epb41l3 APN 17 69247573 missense probably damaging 1.00
IGL02926:Epb41l3 APN 17 69247746 missense probably damaging 1.00
IGL03397:Epb41l3 APN 17 69248692 missense probably damaging 1.00
E0370:Epb41l3 UTSW 17 69274804 missense possibly damaging 0.73
P0031:Epb41l3 UTSW 17 69259054 nonsense probably null
R0032:Epb41l3 UTSW 17 69210384 critical splice donor site probably null
R0056:Epb41l3 UTSW 17 69253397 missense probably damaging 1.00
R0092:Epb41l3 UTSW 17 69286750 missense probably damaging 1.00
R0499:Epb41l3 UTSW 17 69247659 missense probably benign 0.00
R1164:Epb41l3 UTSW 17 69274767 missense possibly damaging 0.93
R1170:Epb41l3 UTSW 17 69259180 nonsense probably null
R1397:Epb41l3 UTSW 17 69262348 critical splice donor site probably null
R2080:Epb41l3 UTSW 17 69253468 missense possibly damaging 0.54
R2138:Epb41l3 UTSW 17 69207880 missense probably damaging 1.00
R2279:Epb41l3 UTSW 17 69270650 missense possibly damaging 0.56
R2863:Epb41l3 UTSW 17 69210321 missense probably benign 0.22
R3883:Epb41l3 UTSW 17 69274116 nonsense probably null
R3884:Epb41l3 UTSW 17 69274116 nonsense probably null
R4165:Epb41l3 UTSW 17 69207888 missense probably damaging 1.00
R4795:Epb41l3 UTSW 17 69248719 critical splice donor site probably null
R5286:Epb41l3 UTSW 17 69262273 missense probably benign 0.00
R5303:Epb41l3 UTSW 17 69257449 missense probably damaging 1.00
R5373:Epb41l3 UTSW 17 69286800 missense probably damaging 1.00
R5374:Epb41l3 UTSW 17 69286800 missense probably damaging 1.00
R5938:Epb41l3 UTSW 17 69259071 missense probably damaging 1.00
R6014:Epb41l3 UTSW 17 69283960 missense probably damaging 0.98
R6059:Epb41l3 UTSW 17 69284642 missense probably damaging 1.00
R6059:Epb41l3 UTSW 17 69286798 missense probably damaging 1.00
R7318:Epb41l3 UTSW 17 69266140 missense
X0066:Epb41l3 UTSW 17 69259158 nonsense probably null
Z1088:Epb41l3 UTSW 17 69253522 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGGAAGACTGACTGCTGGACTC -3'
(R):5'- AGGTAAGAACCCAGCCATGTGCTC -3'

Sequencing Primer
(F):5'- TGGACTCTGTCTTACTCTGAATATAG -3'
(R):5'- GCCTGTCATTAGCCCAATTAGAG -3'
Posted On2013-06-11