Incidental Mutation 'R0560:0610009O20Rik'
List |< first << previous [record 18 of 386652] next >> last >|
ID45847
Institutional Source Beutler Lab
Gene Symbol 0610009O20Rik
Ensembl Gene ENSMUSG00000024442
Gene NameRIKEN cDNA 0610009O20 gene
Synonyms
MMRRC Submission
Accession Numbers
Stock #R0560 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location38250249-38262629 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 38254498 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 230 (L230Q)
Ref Sequence ENSEMBL: ENSMUSP00000025314 (fasta)
Gene Model predicted sequence gene model
Predicted Effect probably damaging
Transcript: ENSMUST00000025314
AA Change: L230Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025314
Gene: ENSMUSG00000024442
AA Change: L230Q

DomainStartEndE-ValueType
low complexity region 6 23 N/A INTRINSIC
low complexity region 35 46 N/A INTRINSIC
low complexity region 127 140 N/A INTRINSIC
SEL1 244 277 1.53e2 SMART
SEL1 278 313 2.8e-9 SMART
SEL1 314 351 3.3e1 SMART
SEL1 352 385 1.31e0 SMART
SEL1 386 421 1.67e-7 SMART
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.0%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 100% (26/26)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr3b T C 5: 25,809,780 probably benign Het
AI464131 G A 4: 41,498,167 R488W probably damaging Het
Apob T C 12: 8,005,101 Y1367H probably damaging Het
Arsb A G 13: 93,790,198 T159A probably damaging Het
Asb18 A C 1: 90,014,528 V17G probably damaging Het
Azi2 T C 9: 118,051,341 probably benign Het
Bicd1 A G 6: 149,511,962 K284E probably benign Het
Bspry A G 4: 62,486,449 R161G probably damaging Het
Ccdc138 A G 10: 58,575,717 T636A probably damaging Het
Ccdc39 A T 3: 33,841,194 probably benign Het
Cubn A T 2: 13,428,680 W1140R probably damaging Het
Cyp2t4 A G 7: 27,158,511 T487A probably damaging Het
Dtx3l A G 16: 35,932,935 S434P probably damaging Het
Duox2 A G 2: 122,291,554 V611A probably benign Het
Epb4.1l3 T G 17: 69,274,897 probably null Het
Fam161b C T 12: 84,357,718 D63N probably damaging Het
Glud1 T C 14: 34,340,024 probably benign Het
Gm5422 G A 10: 31,249,244 V360M probably damaging Het
Gpr158 A T 2: 21,825,274 D710V probably damaging Het
Krtcap2 T C 3: 89,249,142 probably null Het
Mtrf1 T A 14: 79,406,850 D199E probably damaging Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Ncf2 T A 1: 152,821,522 Y125N probably damaging Het
Ovgp1 T C 3: 105,986,410 S500P unknown Het
Ptprz1 A G 6: 23,022,189 probably benign Het
Siglec1 G T 2: 131,070,346 T1692N probably benign Het
Slc10a2 T C 8: 5,089,092 N284S probably benign Het
Slfn3 T C 11: 83,213,152 F160S probably damaging Het
Sorcs1 T A 19: 50,475,376 probably benign Het
Trank1 T C 9: 111,391,086 F2297S possibly damaging Het
Vmn2r69 A G 7: 85,409,714 probably null Het
Vps13d T C 4: 145,054,190 E3982G probably damaging Het
Other mutations in 0610009O20Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02216:0610009O20Rik APN 18 38252860 missense probably damaging 1.00
IGL02456:0610009O20Rik APN 18 38261124 missense probably damaging 1.00
R0134:0610009O20Rik UTSW 18 38261264 missense probably benign 0.37
R0225:0610009O20Rik UTSW 18 38261264 missense probably benign 0.37
R0511:0610009O20Rik UTSW 18 38254071 critical splice donor site probably null
R1899:0610009O20Rik UTSW 18 38258342 missense probably benign 0.08
R3005:0610009O20Rik UTSW 18 38259959 missense possibly damaging 0.92
R3552:0610009O20Rik UTSW 18 38258365 splice site probably benign
R4418:0610009O20Rik UTSW 18 38261287 unclassified probably null
X0067:0610009O20Rik UTSW 18 38258023 splice acceptor site probably benign
Predicted Primers PCR Primer
(F):5'- AGCCCAGTGACTTTGACTTCCTGC -3'
(R):5'- ACCATGCCACATCTGGTCTACCTAC -3'

Sequencing Primer
(F):5'- TAGCCGAGACTTCGCATCC -3'
(R):5'- cacatctggtctacctaccCAAG -3'
Posted OnJun 11, 2013