Incidental Mutation 'R0561:Lrif1'
ID45859
Institutional Source Beutler Lab
Gene Symbol Lrif1
Ensembl Gene ENSMUSG00000056260
Gene Nameligand dependent nuclear receptor interacting factor 1
Synonyms2010012G17Rik, 4933421E11Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.150) question?
Stock #R0561 (G1)
Quality Score143
Status Not validated
Chromosome3
Chromosomal Location106684987-106736577 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 106732165 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 164 (A164S)
Ref Sequence ENSEMBL: ENSMUSP00000115110 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098750] [ENSMUST00000098751] [ENSMUST00000106736] [ENSMUST00000127003] [ENSMUST00000130105] [ENSMUST00000150513] [ENSMUST00000154973]
Predicted Effect probably damaging
Transcript: ENSMUST00000098750
AA Change: A189S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000096346
Gene: ENSMUSG00000056260
AA Change: A189S

DomainStartEndE-ValueType
Pfam:LRIF1 22 753 1.7e-292 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000098751
SMART Domains Protein: ENSMUSP00000096347
Gene: ENSMUSG00000056260

DomainStartEndE-ValueType
low complexity region 104 117 N/A INTRINSIC
coiled coil region 225 257 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106736
SMART Domains Protein: ENSMUSP00000102347
Gene: ENSMUSG00000056260

DomainStartEndE-ValueType
low complexity region 84 97 N/A INTRINSIC
coiled coil region 205 237 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000106737
SMART Domains Protein: ENSMUSP00000102348
Gene: ENSMUSG00000056260

DomainStartEndE-ValueType
Pfam:LRIF1 22 347 6.2e-145 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122928
Predicted Effect probably damaging
Transcript: ENSMUST00000127003
AA Change: A189S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114163
Gene: ENSMUSG00000056260
AA Change: A189S

DomainStartEndE-ValueType
low complexity region 74 92 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000130105
AA Change: A164S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115110
Gene: ENSMUSG00000056260
AA Change: A164S

DomainStartEndE-ValueType
low complexity region 49 67 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150513
SMART Domains Protein: ENSMUSP00000119815
Gene: ENSMUSG00000056260

DomainStartEndE-ValueType
low complexity region 49 67 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150888
Predicted Effect probably benign
Transcript: ENSMUST00000154973
SMART Domains Protein: ENSMUSP00000120350
Gene: ENSMUSG00000056260

DomainStartEndE-ValueType
low complexity region 49 67 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156544
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194058
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adck1 A G 12: 88,368,434 D30G possibly damaging Het
Apc A T 18: 34,313,303 H1050L possibly damaging Het
Armc2 A G 10: 41,993,192 V166A probably benign Het
Atp6v1b1 A T 6: 83,753,811 I173F probably damaging Het
Bpifb4 A G 2: 153,944,822 D298G probably damaging Het
C4b T A 17: 34,734,417 S1031C probably damaging Het
Calcr A G 6: 3,692,630 I408T probably damaging Het
Catsperg1 T C 7: 29,182,312 N1009S probably damaging Het
Ces2a T C 8: 104,737,533 S266P probably benign Het
Chrna1 A G 2: 73,566,252 V433A possibly damaging Het
Ctnnb1 G A 9: 120,951,722 V291M probably damaging Het
Dcbld1 T C 10: 52,261,936 Y99H probably benign Het
Ddx60 A T 8: 62,017,794 H1440L possibly damaging Het
Dsg1c A T 18: 20,274,775 I393L probably benign Het
Eif5 G T 12: 111,540,516 R128L probably benign Het
Ercc3 A G 18: 32,245,539 D191G possibly damaging Het
Gp1ba A T 11: 70,639,590 probably benign Het
Krt24 C T 11: 99,284,613 E199K probably damaging Het
Map2 A G 1: 66,425,497 D1682G probably damaging Het
Megf8 C T 7: 25,328,832 P274S probably benign Het
Mslnl C T 17: 25,743,203 Q192* probably null Het
Nfkb2 T C 19: 46,309,862 V535A possibly damaging Het
Olfr1196 A G 2: 88,700,570 I253T possibly damaging Het
Olfr1206 T A 2: 88,864,680 V25E possibly damaging Het
Olfr1353 T A 10: 78,969,895 L82* probably null Het
Olfr1494 A T 19: 13,749,298 Y64F probably damaging Het
Olfr884 G T 9: 38,047,827 V202L probably benign Het
Olfr936 C T 9: 39,047,373 M15I probably damaging Het
Pag1 T A 3: 9,699,421 Y224F probably damaging Het
Pbrm1 A C 14: 31,035,991 I193L probably benign Het
Phrf1 T C 7: 141,254,963 V17A probably benign Het
Plekhg2 T G 7: 28,370,483 T42P probably benign Het
Pmp22 T A 11: 63,134,424 W28R probably damaging Het
Ppp1r13b A T 12: 111,866,446 H82Q probably damaging Het
Rgs8 T C 1: 153,665,922 probably null Het
Rtl1 A G 12: 109,593,929 V492A probably damaging Het
Slc22a27 A G 19: 7,880,162 probably null Het
Slx4ip A G 2: 137,066,170 E79G probably null Het
Syde1 C T 10: 78,589,376 R267H probably damaging Het
Tas2r114 A G 6: 131,689,795 I90T probably benign Het
Tjp3 C T 10: 81,273,840 G843D probably benign Het
Tln1 A T 4: 43,550,304 M453K possibly damaging Het
Ttc39a A T 4: 109,440,602 Y408F probably damaging Het
Usp39 T G 6: 72,336,385 Q274P probably damaging Het
Uvrag C T 7: 98,888,561 V476I probably damaging Het
Vcan T A 13: 89,712,253 T332S probably damaging Het
Vcan T A 13: 89,731,464 H22L possibly damaging Het
Wls A G 3: 159,873,068 D89G probably benign Het
Zfhx2 A T 14: 55,065,889 V1546E probably benign Het
Zfp457 T A 13: 67,294,070 H147L probably damaging Het
Other mutations in Lrif1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00870:Lrif1 APN 3 106734641 critical splice donor site probably null
IGL01121:Lrif1 APN 3 106735664 nonsense probably null
IGL01304:Lrif1 APN 3 106731733 missense probably damaging 1.00
IGL02209:Lrif1 APN 3 106731729 missense probably damaging 1.00
IGL02801:Lrif1 APN 3 106734614 missense possibly damaging 0.89
IGL02796:Lrif1 UTSW 3 106735436 missense probably benign 0.25
R0440:Lrif1 UTSW 3 106734398 missense possibly damaging 0.87
R0456:Lrif1 UTSW 3 106731778 missense probably benign 0.06
R1160:Lrif1 UTSW 3 106732717 missense possibly damaging 0.95
R1720:Lrif1 UTSW 3 106733136 missense probably damaging 1.00
R1735:Lrif1 UTSW 3 106735846 makesense probably null
R1843:Lrif1 UTSW 3 106732811 missense probably damaging 0.99
R2016:Lrif1 UTSW 3 106732206 missense possibly damaging 0.94
R2200:Lrif1 UTSW 3 106734558 missense probably damaging 0.98
R3619:Lrif1 UTSW 3 106732546 missense probably damaging 1.00
R4750:Lrif1 UTSW 3 106735564 missense probably benign 0.33
R4878:Lrif1 UTSW 3 106735640 missense probably damaging 1.00
R4945:Lrif1 UTSW 3 106735753 missense probably damaging 1.00
R5286:Lrif1 UTSW 3 106732543 missense probably damaging 0.97
R5682:Lrif1 UTSW 3 106732568 missense possibly damaging 0.70
R6149:Lrif1 UTSW 3 106732327 missense possibly damaging 0.83
R6665:Lrif1 UTSW 3 106735343 intron probably null
R7011:Lrif1 UTSW 3 106732285 missense probably damaging 1.00
Z1088:Lrif1 UTSW 3 106732570 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCACAAGTGCATCTGTTCAATTGCC -3'
(R):5'- AGTGTGTCCTGCCAGAACTGTTG -3'

Sequencing Primer
(F):5'- CTGTGAGGACTGGAAATTTTACACC -3'
(R):5'- GGATTCCAGGCTGTAGATACTCC -3'
Posted On2013-06-11