Incidental Mutation 'R0561:Pmp22'
ID45887
Institutional Source Beutler Lab
Gene Symbol Pmp22
Ensembl Gene ENSMUSG00000018217
Gene Nameperipheral myelin protein 22
SynonymsGas-3
Accession Numbers

Ncbi RefSeq: NM_008885.2; MGI:97631

Is this an essential gene? Possibly essential (E-score: 0.625) question?
Stock #R0561 (G1)
Quality Score198
Status Not validated
Chromosome11
Chromosomal Location63128982-63159547 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 63134424 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 28 (W28R)
Ref Sequence ENSEMBL: ENSMUSP00000104342 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018361] [ENSMUST00000108700] [ENSMUST00000108701] [ENSMUST00000108702]
Predicted Effect probably damaging
Transcript: ENSMUST00000018361
AA Change: W28R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000018361
Gene: ENSMUSG00000018217
AA Change: W28R

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 1 153 5.8e-50 PFAM
Pfam:Claudin_2 13 155 1.1e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108700
AA Change: W28R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104340
Gene: ENSMUSG00000018217
AA Change: W28R

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 1 153 5.8e-50 PFAM
Pfam:Claudin_2 13 155 1.1e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108701
AA Change: W28R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104341
Gene: ENSMUSG00000018217
AA Change: W28R

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 1 153 5.7e-50 PFAM
Pfam:Claudin_2 55 155 1.2e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108702
AA Change: W28R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104342
Gene: ENSMUSG00000018217
AA Change: W28R

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 1 153 5.8e-50 PFAM
Pfam:Claudin_2 13 155 1.1e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140648
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype Strain: 2447704; 3614822
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an integral membrane protein that is a major component of myelin in the peripheral nervous system. Studies suggest two alternately used promoters drive tissue-specific expression. Various mutations of this gene are causes of Charcot-Marie-Tooth disease Type IA, Dejerine-Sottas syndrome, and hereditary neuropathy with liability to pressure palsies. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice with one or two copies of several mutations exhibit tremors, a tendency toward seizures, and partial paralysis associated with demyelination and loss of peripheral axons. Mutants have high juvenile mortality and males are often sterile. [provided by MGI curators]
Allele List at MGI

All alleles(11) : Targeted(4) Spontaneous(3) Chemically induced(4)

Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adck1 A G 12: 88,368,434 D30G possibly damaging Het
Apc A T 18: 34,313,303 H1050L possibly damaging Het
Armc2 A G 10: 41,993,192 V166A probably benign Het
Atp6v1b1 A T 6: 83,753,811 I173F probably damaging Het
Bpifb4 A G 2: 153,944,822 D298G probably damaging Het
C4b T A 17: 34,734,417 S1031C probably damaging Het
Calcr A G 6: 3,692,630 I408T probably damaging Het
Catsperg1 T C 7: 29,182,312 N1009S probably damaging Het
Ces2a T C 8: 104,737,533 S266P probably benign Het
Chrna1 A G 2: 73,566,252 V433A possibly damaging Het
Ctnnb1 G A 9: 120,951,722 V291M probably damaging Het
Dcbld1 T C 10: 52,261,936 Y99H probably benign Het
Ddx60 A T 8: 62,017,794 H1440L possibly damaging Het
Dsg1c A T 18: 20,274,775 I393L probably benign Het
Eif5 G T 12: 111,540,516 R128L probably benign Het
Ercc3 A G 18: 32,245,539 D191G possibly damaging Het
Gp1ba A T 11: 70,639,590 probably benign Het
Krt24 C T 11: 99,284,613 E199K probably damaging Het
Lrif1 G T 3: 106,732,165 A164S probably damaging Het
Map2 A G 1: 66,425,497 D1682G probably damaging Het
Megf8 C T 7: 25,328,832 P274S probably benign Het
Mslnl C T 17: 25,743,203 Q192* probably null Het
Nfkb2 T C 19: 46,309,862 V535A possibly damaging Het
Olfr1196 A G 2: 88,700,570 I253T possibly damaging Het
Olfr1206 T A 2: 88,864,680 V25E possibly damaging Het
Olfr1353 T A 10: 78,969,895 L82* probably null Het
Olfr1494 A T 19: 13,749,298 Y64F probably damaging Het
Olfr884 G T 9: 38,047,827 V202L probably benign Het
Olfr936 C T 9: 39,047,373 M15I probably damaging Het
Pag1 T A 3: 9,699,421 Y224F probably damaging Het
Pbrm1 A C 14: 31,035,991 I193L probably benign Het
Phrf1 T C 7: 141,254,963 V17A probably benign Het
Plekhg2 T G 7: 28,370,483 T42P probably benign Het
Ppp1r13b A T 12: 111,866,446 H82Q probably damaging Het
Rgs8 T C 1: 153,665,922 probably null Het
Rtl1 A G 12: 109,593,929 V492A probably damaging Het
Slc22a27 A G 19: 7,880,162 probably null Het
Slx4ip A G 2: 137,066,170 E79G probably null Het
Syde1 C T 10: 78,589,376 R267H probably damaging Het
Tas2r114 A G 6: 131,689,795 I90T probably benign Het
Tjp3 C T 10: 81,273,840 G843D probably benign Het
Tln1 A T 4: 43,550,304 M453K possibly damaging Het
Ttc39a A T 4: 109,440,602 Y408F probably damaging Het
Usp39 T G 6: 72,336,385 Q274P probably damaging Het
Uvrag C T 7: 98,888,561 V476I probably damaging Het
Vcan T A 13: 89,731,464 H22L possibly damaging Het
Vcan T A 13: 89,712,253 T332S probably damaging Het
Wls A G 3: 159,873,068 D89G probably benign Het
Zfhx2 A T 14: 55,065,889 V1546E probably benign Het
Zfp457 T A 13: 67,294,070 H147L probably damaging Het
Other mutations in Pmp22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01780:Pmp22 APN 11 63158308 missense probably benign
IGL02350:Pmp22 APN 11 63158308 missense probably benign
IGL02357:Pmp22 APN 11 63158308 missense probably benign
IGL02423:Pmp22 APN 11 63158292 missense possibly damaging 0.94
IGL03107:Pmp22 APN 11 63158309 missense probably benign
PIT4431001:Pmp22 UTSW 11 63151241 missense probably benign 0.00
R0025:Pmp22 UTSW 11 63158250 critical splice acceptor site probably null
R0025:Pmp22 UTSW 11 63158250 critical splice acceptor site probably null
R0453:Pmp22 UTSW 11 63151103 intron probably benign
R3858:Pmp22 UTSW 11 63134475 missense probably benign 0.00
R5107:Pmp22 UTSW 11 63158411 missense probably damaging 0.99
R6573:Pmp22 UTSW 11 63158273 missense probably damaging 1.00
R6574:Pmp22 UTSW 11 63158273 missense probably damaging 1.00
R6575:Pmp22 UTSW 11 63158273 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGAATGGCTTGCTGATCTCACTG -3'
(R):5'- GAACACTACACAAGGTGACTGGGAC -3'

Sequencing Primer
(F):5'- TGCTGATCTCACTGGGCAG -3'
(R):5'- CCAGTAGGGACTTTCTAGACCAG -3'
Posted On2013-06-11