Incidental Mutation 'R5926:Dnm1'
ID459875
Institutional Source Beutler Lab
Gene Symbol Dnm1
Ensembl Gene ENSMUSG00000026825
Gene Namedynamin 1
Synonymsdynamin 1, Ftfl
MMRRC Submission 044121-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5926 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location32308471-32353338 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 32315804 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 99 (V99I)
Ref Sequence ENSEMBL: ENSMUSP00000118914 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078352] [ENSMUST00000091089] [ENSMUST00000113350] [ENSMUST00000113352] [ENSMUST00000113365] [ENSMUST00000129156] [ENSMUST00000139624] [ENSMUST00000201433] [ENSMUST00000201440] [ENSMUST00000201494] [ENSMUST00000202578]
Predicted Effect probably benign
Transcript: ENSMUST00000078352
AA Change: V630I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000077461
Gene: ENSMUSG00000026825
AA Change: V630I

DomainStartEndE-ValueType
DYNc 6 245 1.38e-177 SMART
PH 520 627 2.7e-10 SMART
GED 654 745 9.51e-32 SMART
low complexity region 747 761 N/A INTRINSIC
low complexity region 783 816 N/A INTRINSIC
low complexity region 819 830 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000091089
AA Change: V626I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000088618
Gene: ENSMUSG00000026825
AA Change: V626I

DomainStartEndE-ValueType
DYNc 6 245 1.38e-177 SMART
PH 516 623 2.7e-10 SMART
GED 650 741 9.51e-32 SMART
low complexity region 743 757 N/A INTRINSIC
low complexity region 779 812 N/A INTRINSIC
low complexity region 815 826 N/A INTRINSIC
low complexity region 845 860 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113350
AA Change: V630I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000108977
Gene: ENSMUSG00000026825
AA Change: V630I

DomainStartEndE-ValueType
DYNc 6 245 1.38e-177 SMART
PH 520 627 2.7e-10 SMART
GED 654 745 9.51e-32 SMART
low complexity region 747 761 N/A INTRINSIC
low complexity region 783 816 N/A INTRINSIC
low complexity region 819 830 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113352
AA Change: V630I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000108979
Gene: ENSMUSG00000026825
AA Change: V630I

DomainStartEndE-ValueType
DYNc 6 245 1.38e-177 SMART
PH 520 627 2.7e-10 SMART
GED 654 745 9.51e-32 SMART
low complexity region 747 761 N/A INTRINSIC
low complexity region 783 816 N/A INTRINSIC
low complexity region 819 830 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113365
AA Change: V630I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000108992
Gene: ENSMUSG00000026825
AA Change: V630I

DomainStartEndE-ValueType
DYNc 6 245 1.38e-177 SMART
PH 520 627 2.7e-10 SMART
GED 654 745 9.51e-32 SMART
low complexity region 747 761 N/A INTRINSIC
low complexity region 783 816 N/A INTRINSIC
low complexity region 819 830 N/A INTRINSIC
low complexity region 851 861 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129156
AA Change: V99I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000118914
Gene: ENSMUSG00000026825
AA Change: V99I

DomainStartEndE-ValueType
PH 1 96 2.75e-2 SMART
GED 123 214 9.51e-32 SMART
low complexity region 216 230 N/A INTRINSIC
low complexity region 239 258 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139291
SMART Domains Protein: ENSMUSP00000115523
Gene: ENSMUSG00000026825

DomainStartEndE-ValueType
Pfam:GED 1 43 3.3e-7 PFAM
low complexity region 45 59 N/A INTRINSIC
low complexity region 81 114 N/A INTRINSIC
low complexity region 117 128 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139624
AA Change: V630I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000122679
Gene: ENSMUSG00000026825
AA Change: V630I

DomainStartEndE-ValueType
DYNc 6 245 1.38e-177 SMART
PH 520 627 2.7e-10 SMART
GED 654 745 9.51e-32 SMART
low complexity region 747 761 N/A INTRINSIC
low complexity region 783 816 N/A INTRINSIC
low complexity region 819 830 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141633
Predicted Effect probably benign
Transcript: ENSMUST00000155269
SMART Domains Protein: ENSMUSP00000116054
Gene: ENSMUSG00000026825

DomainStartEndE-ValueType
GED 1 53 1.63e-1 SMART
low complexity region 55 69 N/A INTRINSIC
low complexity region 91 124 N/A INTRINSIC
low complexity region 127 138 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156866
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175024
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175066
Predicted Effect probably benign
Transcript: ENSMUST00000201433
AA Change: V630I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000144264
Gene: ENSMUSG00000026825
AA Change: V630I

DomainStartEndE-ValueType
DYNc 6 245 1.38e-177 SMART
PH 520 627 2.7e-10 SMART
GED 654 745 9.51e-32 SMART
low complexity region 747 761 N/A INTRINSIC
low complexity region 783 816 N/A INTRINSIC
low complexity region 819 830 N/A INTRINSIC
low complexity region 851 861 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201440
SMART Domains Protein: ENSMUSP00000144309
Gene: ENSMUSG00000026825

DomainStartEndE-ValueType
Pfam:GED 1 41 5.9e-7 PFAM
low complexity region 43 57 N/A INTRINSIC
low complexity region 66 85 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201494
AA Change: V601I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000144145
Gene: ENSMUSG00000026825
AA Change: V601I

DomainStartEndE-ValueType
DYNc 6 245 6.9e-180 SMART
Pfam:Dynamin_M 413 473 2.1e-14 PFAM
PH 491 598 1.2e-12 SMART
GED 625 716 6.1e-34 SMART
low complexity region 718 732 N/A INTRINSIC
low complexity region 754 787 N/A INTRINSIC
low complexity region 790 801 N/A INTRINSIC
low complexity region 822 832 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000202578
AA Change: V630I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000143955
Gene: ENSMUSG00000026825
AA Change: V630I

DomainStartEndE-ValueType
DYNc 6 245 1.38e-177 SMART
PH 520 627 2.7e-10 SMART
GED 654 745 9.51e-32 SMART
low complexity region 747 761 N/A INTRINSIC
low complexity region 783 816 N/A INTRINSIC
low complexity region 819 830 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the dynamin subfamily of GTP-binding proteins. The encoded protein is a GTPase which is required for membrane recycling, including vesicle endocytosis in neurons. It may also be involved in cellular fission via association with microtubules and actin filaments. Mutations in this gene have been shown to cause seizures. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2014]
PHENOTYPE: Homozygous mice display reduced postnatal viability. Null mutation of this gene results in abnormal synaptic vesicle morphology, and recycling during neuronal activity. Other alleles are associated with seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T A 6: 128,560,645 Y701F probably benign Het
Abra T A 15: 41,866,254 H250L probably damaging Het
Acer2 T C 4: 86,874,568 V27A probably benign Het
Arhgef15 A G 11: 68,951,955 L343S possibly damaging Het
Arnt2 G T 7: 84,343,946 H129N probably damaging Het
Atp9a T A 2: 168,706,271 Y63F probably damaging Het
Brca2 A G 5: 150,534,622 T213A probably benign Het
Cdk5r1 T C 11: 80,478,302 probably null Het
Cyb5r4 C T 9: 87,057,261 L366F probably benign Het
Cyp20a1 T A 1: 60,363,242 I162K possibly damaging Het
Dcaf1 T C 9: 106,838,362 V226A probably benign Het
Ddx41 A T 13: 55,534,299 M232K probably damaging Het
Doc2a T C 7: 126,849,525 V134A probably damaging Het
Ghdc C T 11: 100,768,237 V380M possibly damaging Het
Gldn A G 9: 54,338,438 I424M possibly damaging Het
Haus6 A T 4: 86,599,316 H270Q probably benign Het
Hfe A T 13: 23,708,264 M39K probably damaging Het
Jakmip1 C T 5: 37,085,280 probably benign Het
Kcnb2 A G 1: 15,313,011 N187S probably benign Het
Kcnd2 A G 6: 21,217,085 S263G probably damaging Het
Kcnh1 A G 1: 192,413,077 N481S probably benign Het
Kcnn2 A G 18: 45,685,284 I343V probably benign Het
L3hypdh T A 12: 72,077,185 S300C probably damaging Het
Lrit1 T A 14: 37,055,009 C29S probably damaging Het
Mark3 T A 12: 111,592,734 V70E probably damaging Het
Med16 C T 10: 79,902,528 V319M probably damaging Het
Mindy3 T C 2: 12,348,100 Y430C probably damaging Het
Mup5 A T 4: 61,833,049 F121I probably benign Het
Myt1l G A 12: 29,832,332 G509R unknown Het
Notch1 A G 2: 26,476,104 Y813H probably benign Het
Olfr1415 A T 1: 92,491,566 L63Q probably damaging Het
Olfr473 T C 7: 107,933,903 S128P probably damaging Het
Olfr512 T C 7: 108,713,587 L66S probably damaging Het
Pi4kb A G 3: 94,998,996 Y301C probably damaging Het
Ptch1 A G 13: 63,545,055 S244P probably benign Het
Ptprn G A 1: 75,254,598 T554I probably damaging Het
Ptprt T C 2: 161,564,686 I969V probably benign Het
Raf1 T C 6: 115,619,898 M519V probably benign Het
Ryr1 A G 7: 29,104,360 V622A probably damaging Het
Spaca4 G T 7: 45,725,295 H94Q probably benign Het
Spata31 A G 13: 64,920,725 D229G possibly damaging Het
Tbx6 G A 7: 126,784,853 A359T possibly damaging Het
Trpm8 T A 1: 88,330,747 Y251N probably damaging Het
Vps16 T A 2: 130,443,556 N806K probably damaging Het
Vwf T C 6: 125,604,174 F592L probably damaging Het
Other mutations in Dnm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02219:Dnm1 APN 2 32323450 missense probably benign 0.18
IGL02338:Dnm1 APN 2 32312771 missense probably damaging 1.00
IGL02555:Dnm1 APN 2 32328038 missense probably damaging 1.00
IGL02563:Dnm1 APN 2 32315919 splice site probably null
IGL03006:Dnm1 APN 2 32353121 missense possibly damaging 0.84
IGL03013:Dnm1 APN 2 32336284 missense probably benign 0.13
IGL03347:Dnm1 APN 2 32353187 missense probably benign 0.32
R0180:Dnm1 UTSW 2 32327993 missense probably damaging 0.99
R0242:Dnm1 UTSW 2 32316989 missense possibly damaging 0.55
R0242:Dnm1 UTSW 2 32316989 missense possibly damaging 0.55
R0387:Dnm1 UTSW 2 32320581 missense possibly damaging 0.90
R0608:Dnm1 UTSW 2 32335824 missense possibly damaging 0.89
R1230:Dnm1 UTSW 2 32315909 missense probably damaging 1.00
R1474:Dnm1 UTSW 2 32320584 missense probably benign 0.31
R1703:Dnm1 UTSW 2 32323451 missense probably benign 0.01
R1881:Dnm1 UTSW 2 32323730 missense probably damaging 1.00
R2155:Dnm1 UTSW 2 32314937 missense probably damaging 0.96
R4405:Dnm1 UTSW 2 32335972 missense probably damaging 1.00
R4592:Dnm1 UTSW 2 32336011 missense probably damaging 0.99
R5357:Dnm1 UTSW 2 32336241 missense probably null 0.17
R6135:Dnm1 UTSW 2 32333063 splice site probably null
R6463:Dnm1 UTSW 2 32309591 utr 3 prime probably benign
R6563:Dnm1 UTSW 2 32312726 missense probably damaging 1.00
R6626:Dnm1 UTSW 2 32340880 missense probably damaging 1.00
R6707:Dnm1 UTSW 2 32336241 missense probably null 0.17
R6790:Dnm1 UTSW 2 32333067 missense probably damaging 1.00
R6803:Dnm1 UTSW 2 32312754 missense probably damaging 1.00
R7156:Dnm1 UTSW 2 32340467 missense probably damaging 1.00
R7313:Dnm1 UTSW 2 32336009 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTGAAGCCACCAGTGTATG -3'
(R):5'- TAAAGCTCACATGTCCTCATCC -3'

Sequencing Primer
(F):5'- GAAACTCTCCTCCAGTAGCGAGG -3'
(R):5'- CTACAAGGATTACCGGCA -3'
Posted On2017-02-28