Incidental Mutation 'R5927:Tbx6'
ID459948
Institutional Source Beutler Lab
Gene Symbol Tbx6
Ensembl Gene ENSMUSG00000030699
Gene NameT-box 6
Synonyms
MMRRC Submission 044122-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5927 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location126781483-126785560 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 126784853 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 359 (A359T)
Ref Sequence ENSEMBL: ENSMUSP00000091579 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032936] [ENSMUST00000038614] [ENSMUST00000094037] [ENSMUST00000106356] [ENSMUST00000106357] [ENSMUST00000145762] [ENSMUST00000170882] [ENSMUST00000172352] [ENSMUST00000205786] [ENSMUST00000205935] [ENSMUST00000206353] [ENSMUST00000206570]
Predicted Effect probably benign
Transcript: ENSMUST00000032936
SMART Domains Protein: ENSMUSP00000032936
Gene: ENSMUSG00000030697

DomainStartEndE-ValueType
PP2Ac 20 290 4.04e-147 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000038614
SMART Domains Protein: ENSMUSP00000037332
Gene: ENSMUSG00000042675

DomainStartEndE-ValueType
Pfam:Yippee-Mis18 20 114 6.8e-20 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000094037
AA Change: A359T

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000091579
Gene: ENSMUSG00000030699
AA Change: A359T

DomainStartEndE-ValueType
low complexity region 55 75 N/A INTRINSIC
TBOX 90 278 1.79e-128 SMART
low complexity region 332 348 N/A INTRINSIC
low complexity region 414 428 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106356
SMART Domains Protein: ENSMUSP00000101963
Gene: ENSMUSG00000042675

DomainStartEndE-ValueType
Pfam:Yippee-Mis18 20 114 5.4e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106357
SMART Domains Protein: ENSMUSP00000101964
Gene: ENSMUSG00000042675

DomainStartEndE-ValueType
Pfam:Yippee-Mis18 20 114 5.4e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145762
SMART Domains Protein: ENSMUSP00000115596
Gene: ENSMUSG00000042675

DomainStartEndE-ValueType
Pfam:Yippee-Mis18 20 103 2.5e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150760
Predicted Effect probably benign
Transcript: ENSMUST00000170882
SMART Domains Protein: ENSMUSP00000128753
Gene: ENSMUSG00000042675

DomainStartEndE-ValueType
Pfam:Yippee-Mis18 20 114 5.4e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172352
AA Change: A360T

PolyPhen 2 Score 0.336 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000126418
Gene: ENSMUSG00000030699
AA Change: A360T

DomainStartEndE-ValueType
low complexity region 55 75 N/A INTRINSIC
TBOX 90 278 1.79e-128 SMART
low complexity region 333 349 N/A INTRINSIC
low complexity region 415 429 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205786
Predicted Effect probably benign
Transcript: ENSMUST00000205935
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205950
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206143
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206261
Predicted Effect probably benign
Transcript: ENSMUST00000206334
Predicted Effect probably benign
Transcript: ENSMUST00000206353
Predicted Effect probably benign
Transcript: ENSMUST00000206477
Predicted Effect probably benign
Transcript: ENSMUST00000206570
Meta Mutation Damage Score 0.242 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.0%
Validation Efficiency 100% (73/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of a phylogenetically conserved family of genes that share a common DNA-binding domain, the T-box. T-box genes encode transcription factors involved in the regulation of developmental processes. Knockout studies in mice indicate that this gene is important for specification of paraxial mesoderm structures. [provided by RefSeq, Aug 2008]
PHENOTYPE: Homozygous null embryos die during organogenesis exhibiting defects in paraxial mesoderm differentiation, ectopic neural tube development, kinked neural tubes, impaired somite development, hematomas, enlarged tail buds, and laterality defects associated with nodal cilium anomalies. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadm T A 3: 153,939,108 I60F probably damaging Het
Ankrd26 A G 6: 118,507,636 probably null Het
Arhgdib A T 6: 136,924,138 W198R probably damaging Het
Atad5 T A 11: 80,127,285 I1354N probably damaging Het
Ccdc146 T A 5: 21,308,621 K500* probably null Het
Cdk11b G A 4: 155,648,240 probably benign Het
Cmip A T 8: 117,257,309 T70S possibly damaging Het
Col22a1 G T 15: 72,006,966 A114E probably damaging Het
Cpeb1 T C 7: 81,361,680 D171G possibly damaging Het
Crebzf C T 7: 90,444,323 probably benign Het
Cybb C G X: 9,450,750 D246H probably benign Het
D630036H23Rik C A 12: 36,381,672 probably benign Het
Dnah5 A T 15: 28,335,718 T2277S probably benign Het
Dysf T A 6: 84,207,212 F2083Y probably damaging Het
Elavl4 T A 4: 110,290,243 probably benign Het
Elp3 A G 14: 65,582,177 Y111H probably damaging Het
Eps8l2 A T 7: 141,356,346 Q243L probably benign Het
Eri2 C A 7: 119,786,068 L403F probably damaging Het
Fgfr4 T A 13: 55,166,887 N614K probably damaging Het
Gm5108 T G 5: 67,976,871 I74S unknown Het
Gpn1 T C 5: 31,500,891 F130L probably damaging Het
Gpr176 T A 2: 118,373,040 I50F probably benign Het
Gramd1a A G 7: 31,139,821 S221P probably benign Het
Hivep3 A G 4: 120,097,108 T874A possibly damaging Het
Igkv12-40 A G 6: 69,879,399 noncoding transcript Het
Itgb2 C A 10: 77,546,034 P57T probably damaging Het
Kcmf1 T A 6: 72,843,005 D286V possibly damaging Het
Kcnt1 T A 2: 25,909,376 probably benign Het
Kif15 A G 9: 123,017,261 S76G probably benign Het
Kpna3 C T 14: 61,384,647 V223I probably damaging Het
Krt80 A G 15: 101,364,208 probably benign Het
Lama4 A G 10: 39,072,812 Y857C probably damaging Het
Lcorl G T 5: 45,725,424 probably benign Het
Map4k3 A G 17: 80,613,919 V528A probably benign Het
Mmp8 T A 9: 7,563,202 N255K possibly damaging Het
Npat A T 9: 53,562,221 K438* probably null Het
Olfr1246 T A 2: 89,591,100 N5I possibly damaging Het
P4htm T C 9: 108,597,383 Y61C probably damaging Het
Polr3h G T 15: 81,917,279 probably null Het
Prlr C T 15: 10,322,446 T176I probably benign Het
Psme4 T G 11: 30,804,294 F184V possibly damaging Het
Ptgfrn A T 3: 101,060,652 F542I possibly damaging Het
Rock1 T C 18: 10,116,792 E448G probably damaging Het
Rpf1 A T 3: 146,519,463 probably null Het
Sectm1b T C 11: 121,055,674 I132V probably benign Het
Sestd1 T A 2: 77,187,159 H688L probably benign Het
Sidt2 T C 9: 45,944,454 Y530C probably damaging Het
Sin3a A T 9: 57,111,111 K938M probably damaging Het
Sin3b C A 8: 72,749,878 R647S probably benign Het
Slc16a14 T C 1: 84,912,267 H439R possibly damaging Het
Stc1 T C 14: 69,032,373 V134A probably benign Het
Stk11ip G A 1: 75,524,691 V24I possibly damaging Het
Thra G A 11: 98,763,688 V295I possibly damaging Het
Tmem8 T C 17: 26,121,998 Y692H probably benign Het
Tnr T C 1: 159,912,766 M1170T probably damaging Het
Tpcn2 T A 7: 145,278,784 I112F probably damaging Het
Trdv2-2 T C 14: 53,961,541 L96P probably damaging Het
Trim24 T A 6: 37,958,569 W832R probably damaging Het
Usp4 T G 9: 108,391,760 S891A probably benign Het
Vmn1r88 A T 7: 13,178,513 R265S probably benign Het
Vmn2r118 A G 17: 55,624,494 L60S probably benign Het
Wdr74 T C 19: 8,739,833 C220R possibly damaging Het
Xpo1 A T 11: 23,268,653 probably benign Het
Xpo1 A T 11: 23,268,656 probably benign Het
Zfp850 C A 7: 27,990,195 G196V probably benign Het
Other mutations in Tbx6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00499:Tbx6 APN 7 126781529 missense probably damaging 1.00
IGL01899:Tbx6 APN 7 126784532 unclassified probably benign
R1018:Tbx6 UTSW 7 126783192 unclassified probably benign
R1126:Tbx6 UTSW 7 126784719 missense probably damaging 1.00
R2045:Tbx6 UTSW 7 126782883 missense probably damaging 1.00
R4913:Tbx6 UTSW 7 126784535 critical splice acceptor site probably null
R5251:Tbx6 UTSW 7 126783344 missense probably damaging 1.00
R5926:Tbx6 UTSW 7 126784853 missense possibly damaging 0.53
R6285:Tbx6 UTSW 7 126781568 missense possibly damaging 0.57
R7072:Tbx6 UTSW 7 126784740 missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- CATGGGGCCAAAACTGAGAC -3'
(R):5'- GGCTGTAGGTCCAGAAATGC -3'

Sequencing Primer
(F):5'- GGAACCTCCCCTAACCAATCTGTG -3'
(R):5'- CTGTAGGTCCAGAAATGCAGCTG -3'
Posted On2017-02-28