Incidental Mutation 'R5927:Cmip'
ID459952
Institutional Source Beutler Lab
Gene Symbol Cmip
Ensembl Gene ENSMUSG00000034390
Gene Namec-Maf inducing protein
Synonyms
MMRRC Submission 044122-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.946) question?
Stock #R5927 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location117257064-117459430 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 117257309 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 70 (T70S)
Ref Sequence ENSEMBL: ENSMUSP00000130264 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166750]
Predicted Effect possibly damaging
Transcript: ENSMUST00000166750
AA Change: T70S

PolyPhen 2 Score 0.853 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000130264
Gene: ENSMUSG00000034390
AA Change: T70S

DomainStartEndE-ValueType
PH 54 163 2.71e-1 SMART
low complexity region 394 407 N/A INTRINSIC
SCOP:d1a9na_ 652 769 6e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211913
Meta Mutation Damage Score 0.094 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.0%
Validation Efficiency 100% (73/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a c-Maf inducing protein that plays a role in T-cell signaling pathway. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadm T A 3: 153,939,108 I60F probably damaging Het
Ankrd26 A G 6: 118,507,636 probably null Het
Arhgdib A T 6: 136,924,138 W198R probably damaging Het
Atad5 T A 11: 80,127,285 I1354N probably damaging Het
Ccdc146 T A 5: 21,308,621 K500* probably null Het
Cdk11b G A 4: 155,648,240 probably benign Het
Col22a1 G T 15: 72,006,966 A114E probably damaging Het
Cpeb1 T C 7: 81,361,680 D171G possibly damaging Het
Crebzf C T 7: 90,444,323 probably benign Het
Cybb C G X: 9,450,750 D246H probably benign Het
D630036H23Rik C A 12: 36,381,672 probably benign Het
Dnah5 A T 15: 28,335,718 T2277S probably benign Het
Dysf T A 6: 84,207,212 F2083Y probably damaging Het
Elavl4 T A 4: 110,290,243 probably benign Het
Elp3 A G 14: 65,582,177 Y111H probably damaging Het
Eps8l2 A T 7: 141,356,346 Q243L probably benign Het
Eri2 C A 7: 119,786,068 L403F probably damaging Het
Fgfr4 T A 13: 55,166,887 N614K probably damaging Het
Gm5108 T G 5: 67,976,871 I74S unknown Het
Gpn1 T C 5: 31,500,891 F130L probably damaging Het
Gpr176 T A 2: 118,373,040 I50F probably benign Het
Gramd1a A G 7: 31,139,821 S221P probably benign Het
Hivep3 A G 4: 120,097,108 T874A possibly damaging Het
Igkv12-40 A G 6: 69,879,399 noncoding transcript Het
Itgb2 C A 10: 77,546,034 P57T probably damaging Het
Kcmf1 T A 6: 72,843,005 D286V possibly damaging Het
Kcnt1 T A 2: 25,909,376 probably benign Het
Kif15 A G 9: 123,017,261 S76G probably benign Het
Kpna3 C T 14: 61,384,647 V223I probably damaging Het
Krt80 A G 15: 101,364,208 probably benign Het
Lama4 A G 10: 39,072,812 Y857C probably damaging Het
Lcorl G T 5: 45,725,424 probably benign Het
Map4k3 A G 17: 80,613,919 V528A probably benign Het
Mmp8 T A 9: 7,563,202 N255K possibly damaging Het
Npat A T 9: 53,562,221 K438* probably null Het
Olfr1246 T A 2: 89,591,100 N5I possibly damaging Het
P4htm T C 9: 108,597,383 Y61C probably damaging Het
Polr3h G T 15: 81,917,279 probably null Het
Prlr C T 15: 10,322,446 T176I probably benign Het
Psme4 T G 11: 30,804,294 F184V possibly damaging Het
Ptgfrn A T 3: 101,060,652 F542I possibly damaging Het
Rock1 T C 18: 10,116,792 E448G probably damaging Het
Rpf1 A T 3: 146,519,463 probably null Het
Sectm1b T C 11: 121,055,674 I132V probably benign Het
Sestd1 T A 2: 77,187,159 H688L probably benign Het
Sidt2 T C 9: 45,944,454 Y530C probably damaging Het
Sin3a A T 9: 57,111,111 K938M probably damaging Het
Sin3b C A 8: 72,749,878 R647S probably benign Het
Slc16a14 T C 1: 84,912,267 H439R possibly damaging Het
Stc1 T C 14: 69,032,373 V134A probably benign Het
Stk11ip G A 1: 75,524,691 V24I possibly damaging Het
Tbx6 G A 7: 126,784,853 A359T possibly damaging Het
Thra G A 11: 98,763,688 V295I possibly damaging Het
Tmem8 T C 17: 26,121,998 Y692H probably benign Het
Tnr T C 1: 159,912,766 M1170T probably damaging Het
Tpcn2 T A 7: 145,278,784 I112F probably damaging Het
Trdv2-2 T C 14: 53,961,541 L96P probably damaging Het
Trim24 T A 6: 37,958,569 W832R probably damaging Het
Usp4 T G 9: 108,391,760 S891A probably benign Het
Vmn1r88 A T 7: 13,178,513 R265S probably benign Het
Vmn2r118 A G 17: 55,624,494 L60S probably benign Het
Wdr74 T C 19: 8,739,833 C220R possibly damaging Het
Xpo1 A T 11: 23,268,653 probably benign Het
Xpo1 A T 11: 23,268,656 probably benign Het
Zfp850 C A 7: 27,990,195 G196V probably benign Het
Other mutations in Cmip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02043:Cmip APN 8 117445328 missense probably benign 0.29
IGL02126:Cmip APN 8 117449031 missense probably damaging 0.99
IGL02205:Cmip APN 8 117454975 missense probably damaging 1.00
IGL02352:Cmip APN 8 117411255 splice site probably benign
IGL02359:Cmip APN 8 117411255 splice site probably benign
IGL02558:Cmip APN 8 117449088 missense probably damaging 0.99
R0070:Cmip UTSW 8 117426554 missense probably damaging 0.99
R0335:Cmip UTSW 8 117445366 missense probably damaging 0.99
R1225:Cmip UTSW 8 117445371 missense probably damaging 0.98
R1561:Cmip UTSW 8 117453850 missense probably benign 0.41
R2508:Cmip UTSW 8 117436693 missense probably benign
R2885:Cmip UTSW 8 117384965 missense probably benign 0.01
R3415:Cmip UTSW 8 117349377 critical splice donor site probably null
R4024:Cmip UTSW 8 117447416 missense possibly damaging 0.79
R4168:Cmip UTSW 8 117456917 missense probably damaging 1.00
R4169:Cmip UTSW 8 117456917 missense probably damaging 1.00
R4632:Cmip UTSW 8 117447411 missense possibly damaging 0.88
R4706:Cmip UTSW 8 117377154 missense probably damaging 0.99
R4924:Cmip UTSW 8 117257255 missense probably benign 0.00
R5380:Cmip UTSW 8 117422890 missense probably damaging 0.99
R6212:Cmip UTSW 8 117377156 missense probably damaging 1.00
R6310:Cmip UTSW 8 117429810 missense possibly damaging 0.63
R6747:Cmip UTSW 8 117436879 missense probably benign 0.02
R6881:Cmip UTSW 8 117436595 missense possibly damaging 0.77
R6968:Cmip UTSW 8 117377156 missense probably damaging 1.00
R7003:Cmip UTSW 8 117384988 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- ATGGATGTGACGAGCAGCTC -3'
(R):5'- AAGTCTAGAGGTTCCAGCCCAG -3'

Sequencing Primer
(F):5'- AGATCGAGGAGACCAAGCCGCTGCTT -3'
(R):5'- CAGGCCGGGACTAGGGG -3'
Posted On2017-02-28