Incidental Mutation 'R5927:Kif15'
ID459959
Institutional Source Beutler Lab
Gene Symbol Kif15
Ensembl Gene ENSMUSG00000036768
Gene Namekinesin family member 15
SynonymsHKLP2, Knsl7, N-10 kinesin
MMRRC Submission 044122-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5927 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location122951046-123018733 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 123017261 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 76 (S76G)
Ref Sequence ENSEMBL: ENSMUSP00000149776 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040717] [ENSMUST00000084733] [ENSMUST00000213514] [ENSMUST00000214785] [ENSMUST00000216048] [ENSMUST00000216062]
Predicted Effect probably benign
Transcript: ENSMUST00000040717
AA Change: S1275G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000035490
Gene: ENSMUSG00000036768
AA Change: S1275G

DomainStartEndE-ValueType
KISc 24 371 2.86e-179 SMART
Pfam:Kinesin-relat_1 463 551 6.6e-26 PFAM
coiled coil region 579 643 N/A INTRINSIC
coiled coil region 706 1037 N/A INTRINSIC
coiled coil region 1065 1133 N/A INTRINSIC
Pfam:HMMR_C 1265 1387 3.5e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000084733
SMART Domains Protein: ENSMUSP00000081784
Gene: ENSMUSG00000066233

DomainStartEndE-ValueType
transmembrane domain 37 59 N/A INTRINSIC
transmembrane domain 66 88 N/A INTRINSIC
transmembrane domain 98 120 N/A INTRINSIC
transmembrane domain 127 144 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000213514
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213945
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214077
Predicted Effect unknown
Transcript: ENSMUST00000214311
AA Change: S144G
Predicted Effect probably benign
Transcript: ENSMUST00000214785
Predicted Effect probably benign
Transcript: ENSMUST00000216048
Predicted Effect probably benign
Transcript: ENSMUST00000216062
AA Change: S76G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217036
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217077
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217612
Meta Mutation Damage Score 0.052 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.0%
Validation Efficiency 100% (73/73)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadm T A 3: 153,939,108 I60F probably damaging Het
Ankrd26 A G 6: 118,507,636 probably null Het
Arhgdib A T 6: 136,924,138 W198R probably damaging Het
Atad5 T A 11: 80,127,285 I1354N probably damaging Het
Ccdc146 T A 5: 21,308,621 K500* probably null Het
Cdk11b G A 4: 155,648,240 probably benign Het
Cmip A T 8: 117,257,309 T70S possibly damaging Het
Col22a1 G T 15: 72,006,966 A114E probably damaging Het
Cpeb1 T C 7: 81,361,680 D171G possibly damaging Het
Crebzf C T 7: 90,444,323 probably benign Het
Cybb C G X: 9,450,750 D246H probably benign Het
D630036H23Rik C A 12: 36,381,672 probably benign Het
Dnah5 A T 15: 28,335,718 T2277S probably benign Het
Dysf T A 6: 84,207,212 F2083Y probably damaging Het
Elavl4 T A 4: 110,290,243 probably benign Het
Elp3 A G 14: 65,582,177 Y111H probably damaging Het
Eps8l2 A T 7: 141,356,346 Q243L probably benign Het
Eri2 C A 7: 119,786,068 L403F probably damaging Het
Fgfr4 T A 13: 55,166,887 N614K probably damaging Het
Gm5108 T G 5: 67,976,871 I74S unknown Het
Gpn1 T C 5: 31,500,891 F130L probably damaging Het
Gpr176 T A 2: 118,373,040 I50F probably benign Het
Gramd1a A G 7: 31,139,821 S221P probably benign Het
Hivep3 A G 4: 120,097,108 T874A possibly damaging Het
Igkv12-40 A G 6: 69,879,399 noncoding transcript Het
Itgb2 C A 10: 77,546,034 P57T probably damaging Het
Kcmf1 T A 6: 72,843,005 D286V possibly damaging Het
Kcnt1 T A 2: 25,909,376 probably benign Het
Kpna3 C T 14: 61,384,647 V223I probably damaging Het
Krt80 A G 15: 101,364,208 probably benign Het
Lama4 A G 10: 39,072,812 Y857C probably damaging Het
Lcorl G T 5: 45,725,424 probably benign Het
Map4k3 A G 17: 80,613,919 V528A probably benign Het
Mmp8 T A 9: 7,563,202 N255K possibly damaging Het
Npat A T 9: 53,562,221 K438* probably null Het
Olfr1246 T A 2: 89,591,100 N5I possibly damaging Het
P4htm T C 9: 108,597,383 Y61C probably damaging Het
Polr3h G T 15: 81,917,279 probably null Het
Prlr C T 15: 10,322,446 T176I probably benign Het
Psme4 T G 11: 30,804,294 F184V possibly damaging Het
Ptgfrn A T 3: 101,060,652 F542I possibly damaging Het
Rock1 T C 18: 10,116,792 E448G probably damaging Het
Rpf1 A T 3: 146,519,463 probably null Het
Sectm1b T C 11: 121,055,674 I132V probably benign Het
Sestd1 T A 2: 77,187,159 H688L probably benign Het
Sidt2 T C 9: 45,944,454 Y530C probably damaging Het
Sin3a A T 9: 57,111,111 K938M probably damaging Het
Sin3b C A 8: 72,749,878 R647S probably benign Het
Slc16a14 T C 1: 84,912,267 H439R possibly damaging Het
Stc1 T C 14: 69,032,373 V134A probably benign Het
Stk11ip G A 1: 75,524,691 V24I possibly damaging Het
Tbx6 G A 7: 126,784,853 A359T possibly damaging Het
Thra G A 11: 98,763,688 V295I possibly damaging Het
Tmem8 T C 17: 26,121,998 Y692H probably benign Het
Tnr T C 1: 159,912,766 M1170T probably damaging Het
Tpcn2 T A 7: 145,278,784 I112F probably damaging Het
Trdv2-2 T C 14: 53,961,541 L96P probably damaging Het
Trim24 T A 6: 37,958,569 W832R probably damaging Het
Usp4 T G 9: 108,391,760 S891A probably benign Het
Vmn1r88 A T 7: 13,178,513 R265S probably benign Het
Vmn2r118 A G 17: 55,624,494 L60S probably benign Het
Wdr74 T C 19: 8,739,833 C220R possibly damaging Het
Xpo1 A T 11: 23,268,653 probably benign Het
Xpo1 A T 11: 23,268,656 probably benign Het
Zfp850 C A 7: 27,990,195 G196V probably benign Het
Other mutations in Kif15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01459:Kif15 APN 9 122975755 missense probably damaging 1.00
IGL01577:Kif15 APN 9 122996334 missense probably benign 0.06
IGL01647:Kif15 APN 9 122963471 intron probably benign
IGL01921:Kif15 APN 9 122979504 missense probably damaging 1.00
IGL02040:Kif15 APN 9 123017385 missense probably damaging 0.99
IGL02191:Kif15 APN 9 122975679 missense probably damaging 1.00
IGL02218:Kif15 APN 9 122995827 splice site probably benign
IGL02537:Kif15 APN 9 122993849 missense probably benign 0.08
IGL02814:Kif15 APN 9 123003640 missense possibly damaging 0.83
PIT4480001:Kif15 UTSW 9 123011543 missense probably benign
R0034:Kif15 UTSW 9 122999285 missense possibly damaging 0.47
R0458:Kif15 UTSW 9 123009359 missense probably benign
R0526:Kif15 UTSW 9 122997797 missense probably damaging 0.96
R0533:Kif15 UTSW 9 123009433 unclassified probably benign
R0726:Kif15 UTSW 9 122959928 missense probably benign 0.21
R1580:Kif15 UTSW 9 122959956 missense probably benign 0.22
R1597:Kif15 UTSW 9 122994009 missense probably benign 0.22
R2096:Kif15 UTSW 9 122986187 missense probably damaging 1.00
R3125:Kif15 UTSW 9 122987961 missense probably damaging 0.99
R3176:Kif15 UTSW 9 122987840 splice site probably benign
R4088:Kif15 UTSW 9 122986189 missense probably benign 0.29
R4308:Kif15 UTSW 9 123013982 missense probably benign 0.00
R4597:Kif15 UTSW 9 122993849 missense probably benign 0.08
R4705:Kif15 UTSW 9 122959993 splice site probably null
R4832:Kif15 UTSW 9 123002126 splice site probably null
R5100:Kif15 UTSW 9 122991994 missense probably damaging 0.98
R5126:Kif15 UTSW 9 122975758 missense probably damaging 1.00
R5180:Kif15 UTSW 9 122999210 missense probably damaging 0.99
R5247:Kif15 UTSW 9 122986442 missense possibly damaging 0.65
R5376:Kif15 UTSW 9 122993971 missense probably benign 0.04
R5392:Kif15 UTSW 9 122996295 missense probably damaging 0.99
R5422:Kif15 UTSW 9 122984889 synonymous probably null
R5562:Kif15 UTSW 9 122978016 missense probably damaging 1.00
R5663:Kif15 UTSW 9 122991851 splice site probably null
R5767:Kif15 UTSW 9 123013974 missense possibly damaging 0.78
R6049:Kif15 UTSW 9 123011622 missense probably damaging 0.98
R6435:Kif15 UTSW 9 122986491 missense probably damaging 1.00
R7040:Kif15 UTSW 9 123011614 missense possibly damaging 0.67
R7158:Kif15 UTSW 9 122999314 missense probably benign
R7163:Kif15 UTSW 9 123017657 missense probably damaging 1.00
R7197:Kif15 UTSW 9 123009926 critical splice donor site probably null
R7318:Kif15 UTSW 9 122987949 missense probably damaging 1.00
R7360:Kif15 UTSW 9 122991137 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCACCTAGGTTCAGTCCAGTTC -3'
(R):5'- TCTCTGCACACTAGAGAAACTG -3'

Sequencing Primer
(F):5'- AGGTTCAGTCCAGTTCTAGCTTATGC -3'
(R):5'- GTATTTCTACATAGCATGGAAAACCC -3'
Posted On2017-02-28