Mutagenetix > Incidental Mutation

Incidental Mutation 'R0563:Dcdc5'

45997

Institutional Source

Beutler Lab

Gene Symbol

Dcdc5

Ensembl Gene

ENSMUSG00000074981

Gene Name

doublecortin domain containing 5

Synonyms

4732421G10Rik, EG436559

MMRRC Submission

038754-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.113) question?

Stock #

R0563 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

105833674-106236496 bp(+) (GRCm39)

Type of Mutation

exon

DNA Base Change (assembly)

G to A at 106180035 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s):

AlphaFold

no structure available at present

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000122388

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152776

Meta Mutation Damage Score

0.2293

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.6%
20x: 93.3%

Validation Efficiency

98% (52/53)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the doublecortin family. The protein encoded by this gene contains two doublecortin domains. The doublecortin domain has been demonstrated to bind tubulin and enhance microtubule polymerization. Alternatively spliced transcript variants encoding distinct isoforms have been found, but the full-length nature of some variants is not determined. [provided by RefSeq, Feb 2011]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrb3	G	T	1: 25,586,635 (GRCm39)	P146T	probably damaging	Het
Ambn	A	C	5: 88,611,309 (GRCm39)	N163T	probably benign	Het
Ankrd36	A	T	11: 5,579,322 (GRCm39)	E870D	probably benign	Het
Cdc123	T	C	2: 5,803,212 (GRCm39)	N269S	probably benign	Het
Cdc7	A	T	5: 107,120,776 (GRCm39)		probably benign	Het
Cdh2	A	T	18: 16,762,738 (GRCm39)	V402D	possibly damaging	Het
Cwc27	C	A	13: 104,797,865 (GRCm39)	E365*	probably null	Het
Eif4g3	T	C	4: 137,903,151 (GRCm39)		probably benign	Het
Elovl4	C	T	9: 83,667,087 (GRCm39)		probably null	Het
Fhl5	T	G	4: 25,213,610 (GRCm39)	I109L	probably damaging	Het
Gm16181	A	G	17: 35,442,872 (GRCm39)		probably benign	Het
Gna14	A	G	19: 16,585,483 (GRCm39)	Y287C	probably benign	Het
Greb1	A	T	12: 16,730,268 (GRCm39)	C1720S	probably benign	Het
Gypa	T	A	8: 81,236,089 (GRCm39)	S165T	probably benign	Het
Hephl1	T	C	9: 14,993,241 (GRCm39)	D531G	probably damaging	Het
Hsf2bp	A	T	17: 32,226,692 (GRCm39)	L221Q	probably damaging	Het
Itsn1	A	G	16: 91,617,684 (GRCm39)		probably benign	Het
Kif7	T	C	7: 79,352,020 (GRCm39)	E914G	probably benign	Het
Lrp1b	T	C	2: 40,640,926 (GRCm39)	D3506G	probably benign	Het
Lrrc28	T	C	7: 67,195,135 (GRCm39)	N225S	probably damaging	Het
Lysmd4	T	A	7: 66,875,925 (GRCm39)	L196Q	probably benign	Het
Megf8	T	C	7: 25,041,820 (GRCm39)	C1245R	probably damaging	Het
Mgat4f	A	G	1: 134,317,777 (GRCm39)	K183R	probably benign	Het
Mib2	C	T	4: 155,743,917 (GRCm39)	G42S	probably damaging	Het
Mindy2	T	A	9: 70,538,334 (GRCm39)	I334L	possibly damaging	Het
Mrm1	A	G	11: 84,705,539 (GRCm39)	S287P	probably damaging	Het
Ncor1	A	G	11: 62,234,056 (GRCm39)	I382T	probably damaging	Het
Nectin1	A	G	9: 43,702,342 (GRCm39)	T30A	probably benign	Het
Nelfe	A	G	17: 35,073,215 (GRCm39)	E250G	possibly damaging	Het
Nsd1	C	A	13: 55,394,391 (GRCm39)	T767K	possibly damaging	Het
Or1i2	G	A	10: 78,448,467 (GRCm39)	P3S	probably benign	Het
Or1j18	A	T	2: 36,625,013 (GRCm39)	K227*	probably null	Het
Or4e5	T	A	14: 52,727,714 (GRCm39)	K236*	probably null	Het
Or5b111	A	G	19: 13,291,112 (GRCm39)	I179T	probably benign	Het
Pcnx1	A	G	12: 81,964,718 (GRCm39)	D295G	probably damaging	Het
Pex14	A	G	4: 149,046,003 (GRCm39)	V309A	possibly damaging	Het
Phf14	C	T	6: 11,933,600 (GRCm39)		probably benign	Het
Pnpla6	A	G	8: 3,573,333 (GRCm39)	D399G	possibly damaging	Het
Prim1	A	G	10: 127,862,423 (GRCm39)	D340G	probably damaging	Het
Rb1	A	G	14: 73,454,207 (GRCm39)	F564L	probably damaging	Het
Rcc1l	G	C	5: 134,205,394 (GRCm39)	R54G	probably benign	Het
Rnf151	G	A	17: 24,936,430 (GRCm39)		probably benign	Het
Rnf40	T	C	7: 127,192,048 (GRCm39)	L398P	probably damaging	Het
Robo1	C	T	16: 72,769,174 (GRCm39)	T531I	probably benign	Het
Rps6ka2	A	T	17: 7,521,836 (GRCm39)	I198F	probably damaging	Het
Sgk2	T	C	2: 162,846,164 (GRCm39)	L264P	probably damaging	Het
Slc26a6	T	A	9: 108,734,869 (GRCm39)	I281N	probably damaging	Het
Tnxb	A	T	17: 34,935,921 (GRCm39)	K2657N	probably benign	Het
Tor1aip1	G	A	1: 155,911,554 (GRCm39)	T143M	probably damaging	Het
Tpr	A	G	1: 150,284,609 (GRCm39)	D358G	probably benign	Het
Vstm2b	T	C	7: 40,551,899 (GRCm39)	S76P	probably damaging	Het
Wdr33	A	G	18: 32,019,792 (GRCm39)	K488R	possibly damaging	Het
Ythdc2	T	A	18: 44,997,915 (GRCm39)		probably benign	Het

Other mutations in Dcdc5

Allele	Source	Chr	Coord	Type	Predicted Effect
R0017:Dcdc5	UTSW	2	106,187,541 (GRCm39)	splice site	noncoding transcript
R0017:Dcdc5	UTSW	2	106,187,541 (GRCm39)	splice site	noncoding transcript
R0544:Dcdc5	UTSW	2	106,181,909 (GRCm39)	exon	noncoding transcript
R1456:Dcdc5	UTSW	2	106,181,910 (GRCm39)	exon	noncoding transcript
R1476:Dcdc5	UTSW	2	106,188,977 (GRCm39)	exon	noncoding transcript
R1521:Dcdc5	UTSW	2	106,182,014 (GRCm39)	critical splice donor site	noncoding transcript
R1555:Dcdc5	UTSW	2	106,214,480 (GRCm39)	exon	noncoding transcript
R2280:Dcdc5	UTSW	2	106,202,867 (GRCm39)	critical splice donor site	noncoding transcript
R2304:Dcdc5	UTSW	2	106,166,488 (GRCm39)	critical splice donor site	noncoding transcript
R3775:Dcdc5	UTSW	2	106,202,738 (GRCm39)	exon	noncoding transcript
R4820:Dcdc5	UTSW	2	106,166,420 (GRCm39)	exon	noncoding transcript
R4874:Dcdc5	UTSW	2	106,198,451 (GRCm39)	exon	noncoding transcript
R4910:Dcdc5	UTSW	2	106,195,895 (GRCm39)	exon	noncoding transcript
R5285:Dcdc5	UTSW	2	106,198,500 (GRCm39)	exon	noncoding transcript
R5583:Dcdc5	UTSW	2	106,195,778 (GRCm39)	exon	noncoding transcript
R5634:Dcdc5	UTSW	2	106,234,325 (GRCm39)	exon	noncoding transcript
R6313:Dcdc5	UTSW	2	106,198,516 (GRCm39)	critical splice donor site	noncoding transcript

Predicted Primers

PCR Primer
(F):5'- ACTCCATGACACTGCACTTTGGC -3'
(R):5'- TGGCACAACATTAAAACGTGATTGGAC -3'

Sequencing Primer
(F):5'- ACTGCACTTTGGCCGTTC -3'
(R):5'- CTTAATGAGAATGCATGGGGTTCAC -3'

Posted On

2013-06-11