Incidental Mutation 'R5928:Tpr'
ID459988
Institutional Source Beutler Lab
Gene Symbol Tpr
Ensembl Gene ENSMUSG00000006005
Gene Nametranslocated promoter region, nuclear basket protein
Synonyms2610029M07Rik
MMRRC Submission 044123-MU
Accession Numbers

Genbank: NM_133780; MGI: 1922066

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5928 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location150392838-150449935 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 150428127 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 1343 (I1343T)
Ref Sequence ENSEMBL: ENSMUSP00000112606 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000119161] [ENSMUST00000124973]
Predicted Effect probably benign
Transcript: ENSMUST00000119161
AA Change: I1343T

PolyPhen 2 Score 0.298 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000112606
Gene: ENSMUSG00000006005
AA Change: I1343T

DomainStartEndE-ValueType
coiled coil region 49 370 N/A INTRINSIC
coiled coil region 423 515 N/A INTRINSIC
low complexity region 518 534 N/A INTRINSIC
coiled coil region 539 604 N/A INTRINSIC
low complexity region 690 703 N/A INTRINSIC
low complexity region 782 795 N/A INTRINSIC
low complexity region 811 826 N/A INTRINSIC
low complexity region 1003 1019 N/A INTRINSIC
Pfam:TPR_MLP1_2 1036 1167 9.1e-33 PFAM
coiled coil region 1215 1421 N/A INTRINSIC
coiled coil region 1473 1629 N/A INTRINSIC
internal_repeat_3 1630 1691 1.48e-5 PROSPERO
low complexity region 1695 1717 N/A INTRINSIC
low complexity region 1761 1777 N/A INTRINSIC
internal_repeat_5 1814 1827 5.58e-5 PROSPERO
internal_repeat_3 1819 1881 1.48e-5 PROSPERO
internal_repeat_4 1875 1895 5.58e-5 PROSPERO
internal_repeat_1 1893 1919 2.03e-6 PROSPERO
low complexity region 1920 1933 N/A INTRINSIC
low complexity region 1942 1981 N/A INTRINSIC
low complexity region 1989 2014 N/A INTRINSIC
internal_repeat_4 2017 2036 5.58e-5 PROSPERO
low complexity region 2059 2078 N/A INTRINSIC
internal_repeat_2 2084 2135 3.95e-6 PROSPERO
internal_repeat_5 2127 2140 5.58e-5 PROSPERO
internal_repeat_1 2154 2179 2.03e-6 PROSPERO
internal_repeat_2 2156 2212 3.95e-6 PROSPERO
low complexity region 2239 2251 N/A INTRINSIC
low complexity region 2263 2277 N/A INTRINSIC
low complexity region 2292 2314 N/A INTRINSIC
low complexity region 2346 2357 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124973
AA Change: I1417T

PolyPhen 2 Score 0.185 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000117616
Gene: ENSMUSG00000006005
AA Change: I1417T

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
low complexity region 24 77 N/A INTRINSIC
coiled coil region 123 444 N/A INTRINSIC
coiled coil region 497 589 N/A INTRINSIC
low complexity region 592 608 N/A INTRINSIC
coiled coil region 613 678 N/A INTRINSIC
low complexity region 764 777 N/A INTRINSIC
low complexity region 856 869 N/A INTRINSIC
low complexity region 885 900 N/A INTRINSIC
low complexity region 1077 1093 N/A INTRINSIC
Pfam:TPR_MLP1_2 1112 1240 5.1e-37 PFAM
coiled coil region 1289 1495 N/A INTRINSIC
low complexity region 1682 1698 N/A INTRINSIC
internal_repeat_5 1703 1750 8.04e-5 PROSPERO
internal_repeat_3 1704 1765 1.07e-5 PROSPERO
low complexity region 1769 1791 N/A INTRINSIC
low complexity region 1835 1851 N/A INTRINSIC
internal_repeat_5 1857 1900 8.04e-5 PROSPERO
internal_repeat_6 1887 1911 8.04e-5 PROSPERO
internal_repeat_3 1893 1955 1.07e-5 PROSPERO
internal_repeat_4 1949 1969 4.1e-5 PROSPERO
internal_repeat_1 1967 1993 1.42e-6 PROSPERO
low complexity region 1994 2007 N/A INTRINSIC
low complexity region 2016 2055 N/A INTRINSIC
low complexity region 2063 2088 N/A INTRINSIC
internal_repeat_4 2091 2110 4.1e-5 PROSPERO
internal_repeat_6 2108 2132 8.04e-5 PROSPERO
low complexity region 2133 2152 N/A INTRINSIC
internal_repeat_2 2158 2209 2.78e-6 PROSPERO
internal_repeat_1 2228 2253 1.42e-6 PROSPERO
internal_repeat_2 2230 2286 2.78e-6 PROSPERO
low complexity region 2313 2325 N/A INTRINSIC
low complexity region 2337 2351 N/A INTRINSIC
low complexity region 2366 2388 N/A INTRINSIC
low complexity region 2420 2431 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132522
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150752
Predicted Effect probably benign
Transcript: ENSMUST00000151563
SMART Domains Protein: ENSMUSP00000116012
Gene: ENSMUSG00000006005

DomainStartEndE-ValueType
coiled coil region 1 27 N/A INTRINSIC
coiled coil region 79 235 N/A INTRINSIC
low complexity region 302 324 N/A INTRINSIC
low complexity region 368 384 N/A INTRINSIC
low complexity region 527 540 N/A INTRINSIC
low complexity region 549 588 N/A INTRINSIC
Meta Mutation Damage Score 0.102 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency 97% (90/93)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large coiled-coil protein that forms intranuclear filaments attached to the inner surface of nuclear pore complexes (NPCs). The protein directly interacts with several components of the NPC. It is required for the nuclear export of mRNAs and some proteins. Oncogenic fusions of the 5' end of this gene with several different kinase genes occur in some neoplasias. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(28) : Targeted, other(2) Gene trapped(26)

Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 T A 17: 24,318,185 I475L probably benign Het
Abcc2 C T 19: 43,819,358 R813W probably damaging Het
Adam34 T C 8: 43,652,030 T193A probably benign Het
Adgb T C 10: 10,378,787 D1118G probably damaging Het
Adprh A C 16: 38,447,384 S180A probably benign Het
AI314180 A T 4: 58,849,948 M425K possibly damaging Het
Atad5 A T 11: 80,094,177 D30V probably damaging Het
Best3 G A 10: 117,007,627 D303N probably damaging Het
Bmp2k G C 5: 97,087,736 probably benign Het
Btc A T 5: 91,366,145 V86E probably damaging Het
C530008M17Rik A C 5: 76,841,734 probably benign Het
Cacna2d4 G T 6: 119,281,698 A582S probably benign Het
Carm1 A G 9: 21,575,302 probably benign Het
Catsperg1 A T 7: 29,206,615 S180T probably damaging Het
Ccdc185 A T 1: 182,747,482 H547Q probably benign Het
Ccl6 A G 11: 83,588,832 I115T possibly damaging Het
Cd44 C T 2: 102,824,303 V470M probably damaging Het
Cdc25a T C 9: 109,889,793 V354A probably damaging Het
Cdhr2 C A 13: 54,734,019 Q1122K probably benign Het
Cep290 A G 10: 100,551,830 K1958E probably damaging Het
Cfap53 C T 18: 74,359,740 P512S possibly damaging Het
Chrdl2 A T 7: 100,009,993 probably benign Het
Clec7a A T 6: 129,465,467 F199Y probably damaging Het
Dhx29 A G 13: 112,964,468 K1182E probably benign Het
Dnah11 G T 12: 117,914,636 probably null Het
Dnmt3a A G 12: 3,866,096 S94G possibly damaging Het
Egfem1 T C 3: 29,582,928 V42A possibly damaging Het
Eif3e T A 15: 43,275,332 probably null Het
Exosc9 T A 3: 36,555,625 probably benign Het
Fam92a A G 4: 12,171,919 probably benign Het
Fbxw18 T A 9: 109,700,081 T135S probably damaging Het
Fbxw21 T C 9: 109,143,825 E347G possibly damaging Het
Gcm2 A G 13: 41,103,398 Y292H probably benign Het
Gltpd2 C A 11: 70,519,353 Q46K probably benign Het
Gm6741 A G 17: 91,237,100 Y97C probably damaging Het
Golgb1 T C 16: 36,911,987 L532S probably damaging Het
Hdac3 C T 18: 37,941,341 probably benign Het
Helz2 A T 2: 181,230,384 F2554L possibly damaging Het
Hmbox1 T A 14: 64,823,673 H384L possibly damaging Het
Hmcn1 G T 1: 150,598,897 D4746E possibly damaging Het
Il17rb C A 14: 30,004,275 probably null Het
Irak2 A T 6: 113,676,626 I252F probably damaging Het
Khnyn C T 14: 55,885,887 R33C probably damaging Het
Ksr1 G A 11: 79,059,719 P20L probably damaging Het
Lamc3 T C 2: 31,921,709 Y903H probably benign Het
Miga2 T C 2: 30,368,863 probably benign Het
Mroh2a A C 1: 88,241,618 I672L probably benign Het
Ncoa4 T C 14: 32,166,721 probably null Het
Nphp3 T C 9: 104,035,797 Y925H probably benign Het
Nr2c1 T G 10: 94,188,193 L420R probably damaging Het
Olfr203 G A 16: 59,303,158 E2K probably damaging Het
Olfr74 T A 2: 87,974,036 S210C probably benign Het
Olfr857 A T 9: 19,713,753 T309S probably benign Het
Onecut1 A G 9: 74,862,784 N163S probably benign Het
Pcdhb18 G A 18: 37,490,484 R289Q probably benign Het
Per2 C T 1: 91,444,651 V234I probably damaging Het
Pign A G 1: 105,558,067 V735A possibly damaging Het
Plekha7 T C 7: 116,128,574 K85R probably benign Het
Pnma2 C T 14: 66,916,874 T249I probably benign Het
Polr2b A G 5: 77,345,342 D1057G probably damaging Het
Polrmt A T 10: 79,740,352 L519H probably damaging Het
Ptar1 T C 19: 23,717,913 I248T probably benign Het
Ptprh A C 7: 4,573,508 L251R probably damaging Het
Purg T C 8: 33,386,952 M206T probably benign Het
Pwp2 A T 10: 78,182,456 F134I probably damaging Het
Riok3 T A 18: 12,153,018 H434Q probably benign Het
Sorbs2 A G 8: 45,763,183 I187V probably damaging Het
Tbc1d2b T C 9: 90,219,144 I598V probably benign Het
Tdg T A 10: 82,641,370 V85E probably benign Het
Tfb1m C T 17: 3,543,147 V166I probably benign Het
Tmem163 A T 1: 127,491,646 M274K probably damaging Het
Ttn T A 2: 76,889,450 probably benign Het
Usp34 A G 11: 23,436,040 T2156A probably damaging Het
Vmn1r215 A T 13: 23,076,317 T176S possibly damaging Het
Vps52 C T 17: 33,961,126 P268L possibly damaging Het
Xbp1 G A 11: 5,523,514 probably benign Het
Ythdc2 T A 18: 44,833,205 F169L probably benign Het
Zcchc6 G A 13: 59,822,066 A5V probably benign Het
Zfyve16 T C 13: 92,522,117 R429G probably benign Het
Zzef1 A G 11: 72,912,852 E2504G probably damaging Het
Other mutations in Tpr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00327:Tpr APN 1 150423696 splice site probably benign
IGL00424:Tpr APN 1 150398595 splice site probably benign
IGL01095:Tpr APN 1 150410140 missense possibly damaging 0.95
IGL01347:Tpr APN 1 150426987 missense probably damaging 1.00
IGL01519:Tpr APN 1 150431168 missense probably benign 0.01
IGL01768:Tpr APN 1 150444448 missense possibly damaging 0.85
IGL01939:Tpr APN 1 150413745 missense possibly damaging 0.82
IGL01988:Tpr APN 1 150426999 splice site probably null
IGL02065:Tpr APN 1 150413774 missense probably benign 0.13
IGL02110:Tpr APN 1 150435742 missense probably damaging 0.97
IGL02311:Tpr APN 1 150398653 missense probably damaging 0.97
IGL02454:Tpr APN 1 150431192 missense probably benign 0.00
IGL02569:Tpr APN 1 150425631 unclassified probably benign
IGL03168:Tpr APN 1 150408757 missense probably benign 0.04
IGL03193:Tpr APN 1 150440080 missense possibly damaging 0.85
IGL03333:Tpr APN 1 150426967 missense probably benign 0.04
F6893:Tpr UTSW 1 150393562 missense possibly damaging 0.84
PIT4305001:Tpr UTSW 1 150440137 missense possibly damaging 0.85
PIT4469001:Tpr UTSW 1 150403956 missense probably benign 0.41
R0085:Tpr UTSW 1 150417413 missense possibly damaging 0.95
R0101:Tpr UTSW 1 150409302 splice site probably benign
R0116:Tpr UTSW 1 150410147 missense probably damaging 0.98
R0136:Tpr UTSW 1 150430595 missense probably benign 0.01
R0207:Tpr UTSW 1 150417427 missense possibly damaging 0.74
R0219:Tpr UTSW 1 150443258 splice site probably null
R0380:Tpr UTSW 1 150412947 missense probably benign 0.27
R0403:Tpr UTSW 1 150407414 splice site probably benign
R0469:Tpr UTSW 1 150423667 frame shift probably null
R0480:Tpr UTSW 1 150428241 missense possibly damaging 0.83
R0514:Tpr UTSW 1 150402273 missense possibly damaging 0.55
R0563:Tpr UTSW 1 150408858 missense probably benign 0.13
R0631:Tpr UTSW 1 150422531 missense probably damaging 0.98
R0685:Tpr UTSW 1 150433725 missense possibly damaging 0.69
R0730:Tpr UTSW 1 150393407 utr 5 prime probably benign
R0739:Tpr UTSW 1 150407497 missense possibly damaging 0.94
R0780:Tpr UTSW 1 150431341 missense probably benign 0.00
R1018:Tpr UTSW 1 150442183 missense possibly damaging 0.53
R1084:Tpr UTSW 1 150442161 missense probably benign 0.18
R1532:Tpr UTSW 1 150418000 missense probably damaging 0.99
R1551:Tpr UTSW 1 150436801 missense probably benign 0.00
R1608:Tpr UTSW 1 150426893 missense probably damaging 0.96
R1759:Tpr UTSW 1 150429524 missense probably benign 0.19
R1817:Tpr UTSW 1 150419903 missense probably damaging 0.98
R1932:Tpr UTSW 1 150421663 missense probably benign 0.00
R1978:Tpr UTSW 1 150419907 missense possibly damaging 0.65
R2031:Tpr UTSW 1 150442119 missense probably benign
R2176:Tpr UTSW 1 150419940 missense possibly damaging 0.56
R2235:Tpr UTSW 1 150442092 missense probably benign 0.33
R2339:Tpr UTSW 1 150413774 missense probably benign 0.01
R2367:Tpr UTSW 1 150433728 missense probably damaging 0.99
R2507:Tpr UTSW 1 150392944 start codon destroyed probably null
R3931:Tpr UTSW 1 150435904 missense probably damaging 1.00
R4320:Tpr UTSW 1 150423574 missense possibly damaging 0.96
R4439:Tpr UTSW 1 150403961 missense probably benign 0.01
R4568:Tpr UTSW 1 150392959 unclassified probably benign
R4644:Tpr UTSW 1 150423499 missense probably benign 0.01
R4665:Tpr UTSW 1 150444399 missense probably damaging 0.97
R4672:Tpr UTSW 1 150423567 missense probably benign 0.45
R4673:Tpr UTSW 1 150423567 missense probably benign 0.45
R4735:Tpr UTSW 1 150442196 missense possibly damaging 0.91
R4767:Tpr UTSW 1 150430529 intron probably benign
R4772:Tpr UTSW 1 150413113 missense possibly damaging 0.46
R4815:Tpr UTSW 1 150398608 missense probably benign 0.01
R4839:Tpr UTSW 1 150449197 nonsense probably null
R4844:Tpr UTSW 1 150445879 missense possibly damaging 0.86
R4925:Tpr UTSW 1 150432565 missense probably benign 0.00
R4967:Tpr UTSW 1 150410059 missense probably damaging 0.99
R5017:Tpr UTSW 1 150398637 missense probably benign 0.00
R5096:Tpr UTSW 1 150446202 missense probably damaging 0.99
R5353:Tpr UTSW 1 150445924 missense probably damaging 1.00
R5354:Tpr UTSW 1 150445924 missense probably damaging 1.00
R5484:Tpr UTSW 1 150426888 missense probably benign 0.33
R5601:Tpr UTSW 1 150435853 missense possibly damaging 0.75
R5642:Tpr UTSW 1 150423818 missense probably damaging 0.99
R5779:Tpr UTSW 1 150423541 missense probably damaging 1.00
R5787:Tpr UTSW 1 150395286 missense probably benign 0.01
R5892:Tpr UTSW 1 150407400 missense probably benign 0.44
R5915:Tpr UTSW 1 150425649 missense probably benign 0.15
R6146:Tpr UTSW 1 150423162 missense possibly damaging 0.83
R6154:Tpr UTSW 1 150423816 missense probably benign 0.00
R6234:Tpr UTSW 1 150418039 missense probably benign 0.02
R6263:Tpr UTSW 1 150442245 critical splice donor site probably null
R6318:Tpr UTSW 1 150445888 missense possibly damaging 0.93
R6550:Tpr UTSW 1 150423977 missense probably damaging 1.00
R6592:Tpr UTSW 1 150411905 missense possibly damaging 0.83
R6704:Tpr UTSW 1 150406508 missense possibly damaging 0.80
R6716:Tpr UTSW 1 150414765 missense probably damaging 1.00
R6836:Tpr UTSW 1 150436673 intron probably null
R6886:Tpr UTSW 1 150423965 missense probably benign 0.00
R6894:Tpr UTSW 1 150436847 missense probably benign 0.28
R6928:Tpr UTSW 1 150408785 missense possibly damaging 0.83
R7011:Tpr UTSW 1 150433772 missense probably damaging 1.00
R7034:Tpr UTSW 1 150423607 missense probably benign 0.02
R7036:Tpr UTSW 1 150423607 missense probably benign 0.02
R7183:Tpr UTSW 1 150406551 missense probably damaging 1.00
R7221:Tpr UTSW 1 150446178 missense possibly damaging 0.96
R7223:Tpr UTSW 1 150439256 missense possibly damaging 0.53
R7294:Tpr UTSW 1 150403887 missense probably damaging 1.00
R7343:Tpr UTSW 1 150393494 missense unknown
R7361:Tpr UTSW 1 150447621 missense possibly damaging 0.73
R7405:Tpr UTSW 1 150442127 missense probably benign 0.02
X0021:Tpr UTSW 1 150395207 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGTTCAAGTTCATTCACAGCTCTG -3'
(R):5'- TGGGGAAAATCGTGCACTAC -3'

Sequencing Primer
(F):5'- GTTCATTCACAGCTCTGAAAAATG -3'
(R):5'- GCCTTAAGCCTTCCAACT -3'
Posted On2017-02-28